I have a two ranges of columns containing names. I need to count how many times a specific name appears in ColumnN - Easy enough =COUNTIF(N$2:N$1047,Q3) ...Q3 being the name I am looking for.
Now comes the part I am stuck on. I need to count how many times a name appears in ColumnK but only if there is no name in ColumnN.
I tried =IF(COUNTIF(N3:N1047,""),COUNTIF(K2:K1047,T3),)
I want to count the number of times any given number appears either as a consecutive group or singularly.
To give you a context I monitor windturbines and for any given fault code I wish to count the number of events it occurs in a month. Now it could be for 1 hour then clear the next then back for 17 then claer again. That would be 2 events!
I have a somewhat large spreadsheet that is imported from an AS/400 database which shows the number of times something is being used. It lists the object in a row for each use. For instance, if the object is being used 4 times, there would be four rows of this object's name as well as a 0, 1, 2, 3 next to the correct row. Where it is being used is listed in the H Column.
I'm just trying to count the number of times each object is used and where it is used and list it out in another worksheet. Like this:
Object 1, 4 uses, Place 1 2 3 and 4.
Can someone point me in the right direction in terms of where to start with this? I don't mind giving it a shot in terms of the coding but I'm somewhat at a loss in terms of the general "how to".
I have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2","")) in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.
In a datafile I have one column containing a trip 'origin' and a second column contains 'destinations'. I want to count how many times each trip occurs (so the same origin/destination pair). This is doable using COUNTIFS but unfortunately respondents did not provide consequent origins and destinations. I encountered the following formulations
Since the format is different among and within respondents functions containing LEFT, RIGHT, MID are not useful (at least, my trials did fail). I found a VBA-script for a FUZZYVLOOKUP which sounded promising. Unfortunately the data is stored on a remote PC without VBA on it.
Is there a way to count the occurrences of trips given the circumstances?
I have an excel spreadsheet to record employee holiday and sickness figures.
It is set on as a grid e.g. column A stores all the dates and then employee names are used as column header.
One of the triggers I need to use is where, an employee has been absent 28 consecutive days. When an employee is absent I simply enter 'ABSENT' against there name.
Countif will count the number of time absent appears in the column however I need it to only recognise it if it is only 28 days in a row.
What I want is in column B to give the sequential count that each number is for that number. In other words in row one the number 4 appears for the first time and so the sequence number is 1. It next appears in row 4, so the sequence number there is 2, and for row 6, it is 3.
The completed table will look like this:
A B 4 1 3 1 5 1 4 2 3 2 4 3
Any formula for the cells in column B? My actual list is about 5,000 lines and so I need a formula that is not slow.
In need checking if a particular ID number is repeated more than once in column B. I need to write a formula in each cells of "No.of Repetition" column or Column C to check if respective ID number in column B is repeated more than once and display the count or display a condition true or false.
Look at 2 columns and assess if certain criteria and then count the number of these certain criteria. I give an example below:
Column 1: Has a drop down box of possibilities from: "Red", "Amber", "Green", N/A
Column 2: Has a drop down box of possible choices of: "Significant", "Other".
What I would like to do is have a formula which will count the number of times you have "Red and Significant", "Red and Other", "Amber and Significant", "Amber and Other", "Green and Significant", "Green and Other" and "N/A and Significant" and "N/A and Other".
I am working on a spreadsheet that tracks employee attendence and I am hoping there is a formula that can count the number of occurrences (see below) not the number of incidents (total number of times it comes up).
I am trying to find out if Sumproduct or Countif will provide me the answer but in vain. In the example of the 2 columns of data, how do I find out the number of one-time (or unique) combined occurences for data in column A and B? In my example the answer should be 5. I do not how to proceed with my Sumproduct formula which gives error. =SUMPRODUCT(($A$1:$A$17="A122")*$B$1:$B$17)
I am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter
I have a sheet set up to record free pour tests for my bar team.
Column A has the date. Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.
What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.
I can easily count the names, but how do I count if they have pass or failed?
I'm trying to count the number of occurrences where two conditions in a table are true.
I have a table that has two columns for ratings; impact and probability. Each can be scored 1-5 This creates a matrix table of possible scores from 1 - 25 (image attached)
I want to COUNT the number of items in each of the boxes (not the total score). For example, how many are Impact 5 and Probability 5 (25 total); how many are Impact 4 and Probability 2 (8 total), and so on. Basically a count of the each of the intersections in the matrix.
Something like "Countif Impact is 5 AND Probability is 5"
Is it possible to count something once, checking for multiple conditions?
I have a very large range of text; g2:g23000. I am trying to find the number of times ABC shows up in this range and provide a count. The cells contain all bits of information, but i am only looking for ABC.
I have found ways to count cells but what I am trying to do is in column F I have a list of meeting topics, and sometimes these repeat in a year. in my drop down menu I have all of them listed however my supervisor wants me to add a count after the meeting number in the 1_1X format where x is the number of times a topic has been used.
The output will be added to my macro here
Code:
Private Sub Worksheet_BeforeDoubleClick(ByVal Target As Range, Cancel As Boolean)
Dim y As String Dim z As String Dim b as Integer
If Target.Cells.Count > 1 Then Exit Sub If Intersect(Target, Range("MEETINGNUMBER")) Is Nothing Then Exit Sub
I've got a set of data that I update once a month and the number of team members per team changes all the time. I'm trying to write a formula that basically says, if the date matches AND the manager name matches, count the number of team members.
In the attached sample if A2 and B4 are found in the data set, count the number of SalesReps they have. So I'm looking at Sarah for February 2013, she has two sales reps that sold something, but Katherine appears twice, so I'm not looking for a result of 3, the correct answer is 2. How do I write the formula?
A2 will look to the data range of A14:A23 and SarahK will look to I14:I23, but I want to count H14:23.
i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?
I have a very large spreadsheet and want to count the number of times a particular text string shows up in a column. I can't use autofilter due to the 1000 limit.
Here's an example, Column C contains: Dan Parker John Doe Dan Smith Jill Smith
So if I search on *Dan*, the function should return a count of 2.
I've used COUNTIF before to return values when the whole cell = a certain value but in my case the cell may have 200 characters and I want to count based on a fuzzy search. I would like to do this in a function and not a macro.
I am trying to create a graph that is conditional on two different columns. The first column is a date column, the second column has various categories. I want to show how many times each category appears per month. This database is continually added to so I wanted the formula to reflect the entire column range.
For example, let say I have 5 categories (Grapes, Apples, Peach, Pear, Banana). Column A would show a date (in a M/D/Y format) and Column B would list the fruit type. I want to show how many Grapes were input in January, February, March, etc. and then move on to show how many apples in each month, and so on.
I am working on a spreadsheet that will provide count of types of complaints for particular areas over a running time span. I have tried a multitude of formulas but not sure how to write any of them correctly. What I am trying to do is generate a count of area type by whether it is formal or informal. (i.e. I want to know if there are x formal finish issues vs. y informal finish issues and so on.) This information will get charted and be kept "real-time" user input.
I have data arranged in a worksheet (see attachment) that has hours of work broken down by day. What I need is a formula that will find the number of times a record occurred in Column F that is greater than or equal to 12 hours each day. So for March 1st there would be 9 times. I can do that now with no problem using "=COUNTIF(F4:F14,">=12")" However, the real thing that I need is how many days of each month were there only 1 count (of 12 hours or more). So it needs to look at the range of data that goes from 3/1/13 to 3/31/13 and find the total number of days that had 1 count (of 12 hours or more) each day and return the number of days it found.
I get this work a lot and am looking for a much more effective way of working the dataset,
I have numbers like 1.1, 1.2, 1.3 and so on....... These come under criteria like (1) = 1.1, 1.2, 1.3 and so on.....
I am look for an automated way of doing a count of any number that falls under this criteria, so I want to count based on criteria (1) it would count all 1.1,1.2,1.3 and so on as one count.
I am attaching a sample document to see how it is laid out. [URL] .....
I have tried applying the same logic to another formula where I wanted to Also count the number of times “Not Stated” and “In Progress” are shown. However when I do I am receiving a ‘0’ number in return. The formula I wrote was: