Count Up How Many Times A Particular Phrase Within A Text String Appears
Feb 7, 2007
i have a spreadsheet where I need to count up how many times a particular phrase within a text string appears. The text string will be duplicated many times throughout the spreadsheet.
For example :
Miss X was at work on Saturday
Mr XX was at work on Saturday but not Tuesday
Miss Y was at work on Tuesday
So I would like to count up how many times "work on Saturday" appears in my spreadsheet, and then as a seperate query, how many times "work on Tuesday" appears.
I want to count the number of times a word appears in a range (like M9:S663), but sorting it by the month it appears (eg: january = 2, february = 56, march = 2000, etc.)
I managed to do this but there has to be a better way
I want to count how many times a particular text appears in Column A depending on the number times another text appears in Column B.
Say for example if I have in Column A {A, B, C, D}nd column B I have {AA,BB,CC) and if I want to check how many times column A has "A" value when the column B has "CC" value, then how should I proceed with this ?
I have a very large spreadsheet and want to count the number of times a particular text string shows up in a column. I can't use autofilter due to the 1000 limit.
Here's an example, Column C contains: Dan Parker John Doe Dan Smith Jill Smith
So if I search on *Dan*, the function should return a count of 2.
I've used COUNTIF before to return values when the whole cell = a certain value but in my case the cell may have 200 characters and I want to count based on a fuzzy search. I would like to do this in a function and not a macro.
I have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2","")) in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.
I an trying to count how many times the value "Adhesive/tapes" appears in col CV but only where there is a corresponding value of "Prat","Onsite" in col CV......
I thought that this would work but is returning a #Value error....
I am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter
I have a sheet set up to record free pour tests for my bar team.
Column A has the date. Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.
What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.
I can easily count the names, but how do I count if they have pass or failed?
I have a two ranges of columns containing names. I need to count how many times a specific name appears in ColumnN - Easy enough =COUNTIF(N$2:N$1047,Q3) ...Q3 being the name I am looking for.
Now comes the part I am stuck on. I need to count how many times a name appears in ColumnK but only if there is no name in ColumnN.
I tried =IF(COUNTIF(N3:N1047,""),COUNTIF(K2:K1047,T3),)
I've got a set of data that I update once a month and the number of team members per team changes all the time. I'm trying to write a formula that basically says, if the date matches AND the manager name matches, count the number of team members.
In the attached sample if A2 and B4 are found in the data set, count the number of SalesReps they have. So I'm looking at Sarah for February 2013, she has two sales reps that sold something, but Katherine appears twice, so I'm not looking for a result of 3, the correct answer is 2. How do I write the formula?
A2 will look to the data range of A14:A23 and SarahK will look to I14:I23, but I want to count H14:23.
i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?
I have tried applying the same logic to another formula where I wanted to Also count the number of times “Not Stated” and “In Progress” are shown. However when I do I am receiving a ‘0’ number in return. The formula I wrote was:
My Problem is I have a workbook with multiple sheets with a possibility of a number between 2 and 999 occurring. I am looking for a formula that can display a table on the "total" worksheet for every ID number that has been entered and the number of times the ID number is displayed.
I have a few spreadsheets with a few land transactions. I want to see if the parties involved are male or female, or both (in case of joint titles). And how many. I've tried to use ISNUMBER formulas and COUNTIF formulas but I can't seem to make them work. I've attached an example of what I need to do, the original has many more column with more info, and the names are in a different language which makes it easier to identify as female or not (like 'phany' in english female names etc).
I have number of items and many items appear more than once. I need a formula so that counts the number of item appearing maximum number of times and it displays the name of the text written NOT the number of times it is written. It should also calculate number of times it appears in a particular month.
For E.g.
Table 1-5-2012 Chair 1-5-2012 Fan 3-5-2012 Table 10-5-2012 Fan 1-6-2012 Window 1-6-2012 Glass 1-7-2012 Glass 9-7-2012
I am trying to use find and replace but the text that i'm searching for appears three times in the cell. I only need to replace the first occurrence in the cell. Alternatively, if there is a way to do this, can the second and third occurrence be changed?
Example:
Cheryl called Louie to advise she would be late for the meeting. Louie responded that he would meet Cheryl at her office. Cheryl confirmed.
I need to change the first 'Cheryl' to a job title and the second and third Cheryl to her initials (CL) so would read:
Manager of Aboriginal Affairs called Louie to advise she would be late for the meeting. Louie responded that he would meet CL at her office. CL confirmed.
I have a long list of terms, and I need to identify which of these terms appear in another body of text strings. Rather than searching for each individual term, is there a formula that check the terms for me automatically.
The terms will appear in the larger body of text, but they won't appear on their own, so they won't be perfect matches.
I've attached a sheet to try to illustrate the problem.
I'm looking for a formula that can determine whether a given sub-string appears in a string. For example if cell A1 contains the string "bathing", and cell A2 contains the sub-string "bat", the formula in A3 would return "TRUE".
However, if the sub-string in A2 is changed to "cat", the result in A3 would be "FALSE". The formula would need to work with strings of different and unpredictable lengths.
In C1, I need a formula that displays TRUE if any of the 4 numbers from A1 through A4 are contained within the text in B1. If not, FALSE will be displayed.
Been messing with SEARCH and FIND, but not getting it to work.... not sure if those are the functions I need.
I have a filtered list and want to count the number of times each value appears in the filtered list. I also have other hidden rows that I do not want to include in the count and the filtered rows should not be included in the count either. I have tried countif, pivot tables and subtotal .
I currently have a large amount of data extracted from a performance tracking system. The columns I am concerned with are Page Title and Time (the time it takes the system to navigate to the this page).
I am trying to create a dashboard to show:
Webpage Title (each unique instance of the webpage)Aggregate Time (total time it takes for all instances)# of Hits (Each time the value appears in the data)Average Time (this formula I can handle; Aggregate Time/# of Hits)
The major issue is that the webpage is extracted as XYZ001 -- PAGE1, XYZ439 -- PAGE2, XYZ854 -- PAGE1, etc. Basically, I am only concerned with what comes after the --.
Here is an example of the two tabs.
DASHBOARD TAB:
Page Title Aggregate Time # of Hits Avg. Time PAGE1
[Code]...
Basically, I am looking for a formula that says,
For any instance in the Page Title column that contains PAGE3, add the amount in the Time column (i.e., 1.2 +.5).
In the attachment, on the totals sheet I am doing a count of the results on Sheet2. Under "Alcohol as it Applies to Me" on Totals I am trying to count the 5 different categories, but the original question is a pick all that apply so at times there are multiple answers. I can't figure out the formula to count each phrase when there is multiple answers.
I need to count how many times I've got, for instance, "a" in several cells where I typed some text...
I would need a formula where I can indicate the letter I want and the range of cells where to look at, and having as result how many occurances there are...
If you are very good instead of a single letter, maybe a sequence of letters... but this is an extra!
The attached spreadsheet is a sample of a master sheet I need to maintain. Keep in mind that the spreadsheet has hundreds of names on it and 10 sheets in the workbook. What name appears most in the "person who called" column, then I need to know out of all the people who called, what percentage of calls he made....
I have to do this on each sheet, so if it is possible to have it work for all the sheets.
At work I have been tasked with building a summary excel document that details people's names, grades etc. To be accurate, each person has their own positional code (a unique number), which I used in my lookup formula. After weeks of work, I have 1500 odd names down. However, this is 6 short of what I need the number to be. This is the cause of great stress,as this has to be ready on Monday, and I just don't have the time or sanity to sit there copying and pasting a number into find 1500 times to find the 6 numbers I have accidently ticked off as in the document. Therefore, it would be useful if there were some way to tell me how many times a number appears in the document. Each number should obviously appear twice (once in the data sheet, and once in the appropriate table)
I have 2 columns with data in them, basically representing a gaussian distribution. Column A has the "X-axis" values and so is uniformly ascending with no duplicates. Column B has the "Y-axis" values and increases up to a maximum and then decreases again (this is data from an instrument and so its not completely smooth but is close). An example is below.
0 4 1 8 2 16 3 27 4 50 5 27 6 16 7 8 8 4
What I would like to do is get the 2 Column A values where the corresponding column B value is half of the max (in the case above, 25 is not available so the closest is 27). I am trying to calculate the difference between these values, so in the example, I would have 5-3. Is there a way to do this?
A1:A10 contains text (say colors) and B1:B10 also text (say vegetables). I need a formula to count the number of times a certain combination of numbers and vegetables appear in the same column, so if "red" and "carrot" appeared in A4 and B4 and also in A6 and B6, the result would be 2.
I have a sheet which details specific card numbers in Column A, and the date and place of transaction in the Column B. This very long list contains multiple entries for each card number. What I would like to do is use Sheet2 to list each card number and the number of times it appears in the list.
