A1:A10 contains text (say colors) and B1:B10 also text (say vegetables). I need a formula to count the number of times a certain combination of numbers and vegetables appear in the same column, so if "red" and "carrot" appeared in A4 and B4 and also in A6 and B6, the result would be 2.
View 4 Replies
I have a list of names all in one column, separated by row...
Example...
John Doe
John Doe
Jane Doe
Jane Doe
Jane Doe
James Jones
James Jones
I want to count how many times each name appears. Like this:
John Doe | 2
Jane Doe | 3
James Jones | 2
This is a very large list of names and I prefer not to have to type each single name into a formula because there are hundreds of separate names.
I want to count the number of times a word appears in a range (like M9:S663), but sorting it by the month it appears (eg: january = 2, february = 56, march = 2000, etc.)
I managed to do this but there has to be a better way
=COUNTIFS(RNM.1;"PRUM Transcripcion";FechaComite;">=01/01/2012";FechaComite;"=01/01/2012";
FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";
FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";FechaComite;"
I want to count how many times a particular text appears in Column A depending on the number times another text appears in Column B.
Say for example if I have in Column A {A, B, C, D}nd column B I have {AA,BB,CC) and if I want to check how many times column A has "A" value when the column B has "CC" value, then how should I proceed with this ?
I have a few spreadsheets with a few land transactions. I want to see if the parties involved are male or female, or both (in case of joint titles). And how many. I've tried to use ISNUMBER formulas and COUNTIF formulas but I can't seem to make them work. I've attached an example of what I need to do, the original has many more column with more info, and the names are in a different language which makes it easier to identify as female or not (like 'phany' in english female names etc).
View 8 Replies View RelatedI have data like this
textrows to repeatelements in row
MB1216
MB233
MB3116
MB4415
MB558
i want to paste text for MB1 in column B like from MB1-1 to MB1-16 and MB1 2-1 to MB 2-16 because MB1 has 2 rows and 16 elements to repeat, for MB2 in cloumn B like MB2 1-1 to MB2 1-3 and MB2 2-1 to MB2 2-3 and MB2 3-1 to MB2 3-3 because MB has 3 rows and 3 elements to repeat like this i want to continue upto MB5
I am expecting like this
A B
MB1 MB1 1-1
.
.
.
MB1 1-16
MB1 2-1
[code]....
and i would like to continue this for the rest of text in column A .Here i tried with commond button simple and now i am in position to paste text in a given range but not the way i am expecting.
Attached File : sample (2).xlsx
in writing a formula that will count the number of times
the store is listed (Column B) when it matches with closed (Column C).
On the table listed below I will return the data using a match.
From this table
A B C
1/8/2006 9:45Store 1Closed
1/8/2006 9:57Store 2Closed
1/8/2006 10:05Store 3Closed
1/8/2006 10:09Store 4Closed
1/8/2006 10:15Store 5Closed
1/8/2006 10:24Store 1Closed
1/8/2006 10:36Store 2In Progress
1/8/2006 10:41Store 3In Progress
1/8/2006 10:50Store 4Closed
1/8/2006 10:58Store 5Closed
1/8/2006 10:59Store 1Closed
1/8/2006 11:15Store 2Closed
1/8/2006 11:22Store 3In Progress
1/8/2006 11:24Store 4In Progress
1/8/2006 11:33Store 5Closed
1/8/2006 11:51Store 1Closed
1/8/2006 11:56Store 2Closed
1/8/2006 11:57Store 3Closed
1/8/2006 12:03Store 4Closed
1/8/2006 12:16Store 5Not Started
1/8/2006 12:23Store 1Closed
1/8/2006 12:28Store 2Closed
1/8/2006 12:57Store 3Closed
To this table
A B C
1/8/2006 9:45Store 15
1/8/2006 9:57Store 24
1/8/2006 10:05Store 33
1/8/2006 10:09Store 43
I have 25 random numbers and I would like to get a possible 5 digit combinations of these numbers. Can anybody help me with the possible formula?
View 9 Replies View RelatedI need a formula that will show the total number of times "text" is entered into a column and when sorted by year that would only show the total for that year. The COUNTIF formula i'm using only works for the total, not when sorted by year.
View 9 Replies View RelatedAttempting to do a countif as follows
Count the number of times that F2:F65536=Q1 where E2:E65536 also = N2.
So for a given row, the cell in col F needs to equal Q1 and the cell in col E needs to equal N2 for it to count.
I have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2",""))
in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.
I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.
View 9 Replies View RelatedI am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter
View 2 Replies View RelatedI have a sheet set up to record free pour tests for my bar team.
Column A has the date.
Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names
Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.
What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.
I can easily count the names, but how do I count if they have pass or failed?
How I can count the number of times each unique phrase in row "A" is repeated?
For example if my data set was
Blue
Green
Black
Green
Red
Red
Red
Red Hat
how can I get excel to count the number of times and return data like
Blue 1
Green 2
Black 1
Green 2
Red 3
Red 3
Red 3
Red Hat 1
I'm trying to filter data into a cell that meets certain criteria...
I would like to count the number of times a sku is found in each region in each month... daily inventory counts are recorded.. the date is recorded as MM/DD/YYYY...
is sumproduct my solution? I'm getting errors, specifically #NAME?
=sumproduct((sheet1!L:L=SKU)*(sheet1!M:M=Region)*(sheet1!C:C>=1/1/2009)+(sheet1!C:C
Is there a function that allows you to read column A for an ID (these may or may not include letters/numbers/"?", are non-sequential and are of variable lengths) and, if it is the first time that it has seen an ID column B will read "sample_1_arm_1", if its the second time it has seen an id it will read "sample_2_arm_1", etc? An example of what I am trying to do on a much larger scale:
id
event_name
C83-858
sample_1_arm_1
[Code].....
I've got a set of data that I update once a month and the number of team members per team changes all the time. I'm trying to write a formula that basically says, if the date matches AND the manager name matches, count the number of team members.
In the attached sample if A2 and B4 are found in the data set, count the number of SalesReps they have. So I'm looking at Sarah for February 2013, she has two sales reps that sold something, but Katherine appears twice, so I'm not looking for a result of 3, the correct answer is 2. How do I write the formula?
A2 will look to the data range of A14:A23 and SarahK will look to I14:I23, but I want to count H14:23.
I have two columns with values. Then I have a third column with one letter A or B.
I'm not used to excel, but I've tried my way with COUNTIFS and I'm pretty sure it's the way to go, but I'm lost in the syntax.
I want to count the number of times the values in the first column is larger than the values in the second column, if the letter is A. And then flip the ">" sign and count that and hopefully the first number is higher.
i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?
View 8 Replies View RelatedI am sure that most of you will probable know what i am doing wrong here straight away so rather than me waste another 1/2 hr stuffing around. I am trying to find count the number of times two events occur simultaneously.
=SUMPRODUCT(--('5. Financial'!AX4:AX134=A5)*('5. Financial'!BQ4:BQ134>0<0.1))
The first part is fine I think but in the second part I am trying times only when cell is between zero & 10%.
I am using excel 2003. My sheet contains Times in column A and numbers in column B. I want to be able to count how many of those rows fall into time periods. Such as how many are from 8:00-9:00 AM. I do have the time column formatted as Time.
Ex:
A1: 3:40 PM
A2: 8:20 AM
A3: 8:55 AM
A4: 10:23 AM
etc.
B1: 23
B2: 34
B3: 12
B4: 35
etc.
So I want to be able to pull that between 8 and 9 AM there are 2 records.
The second part would be (in another cell) to pull the SUM of the numbers that correspond to the previous question. In the previous example it would be the SUM of all corresponding cells (Column B) that fall within the 8 and 9 AM range. Which would be 46 in this example.
I have used Formula to ID cells containing a formula to flag cells red with conditional formatting in a list that do not have formula.
I need a single cell to change colour if any of the cells in the list do not have a formula. e.g. the subtotal in the top row could go red so the user can scroll down to find individual red cells.
Is there a way to count the red cells without formula in the list - Conditionally formatted cells are hard to count. I don't want to use a vba script to do it as the user probably won't run it and auto run slow calculations down.
Is there an array formula that can return true or false if not(CellHasFormula) is true anywhere in the list?
countif(AH1:AH2976,CellHasFormula) doesn't work.
What I am looking for is to select between 7 and 15 numbers in total, I want all the possible 6 digit combinations for this.
EG: if I choose 2,9,11,13,15,17&26, it would look something like this
2,9,11,13,15,17
2,9,11,13,15,26
9,11,13,15,17,26
And so on.
If I chose more numbers (10) 1,2,3,4,3,6,7,8,9,10 it would start something like this
1,2,3,4,5,6
1,2,3,4,5,7
1,2,3,4,5,8
1,2,3,4,5,9
1,2,3,4,5,10
And so on.
Please remenber I would like to be able to secelt between 7 and 15 number and be given all the possible combinations.
I would like it to be in one sheet but if that can not be done on as many as it takes.
It would be good if I could just type the required number into A1,B1,C1 and so on and they just gave the combinations required.
What formula will count the number of times the value J3 appears in E2:E400. BTW...the a-g is formatted as a table. excel 07
View 3 Replies View RelatedI am attempting to create a formula that will count the number of times, lets say letter A, occurs in column E. However, the tricky part that I have been confused on is that I only want to count how many times A occurs between each hour of the day. I need to count number of times "A" occurs between each hour of the day for the entire month.
My Worksheet looks as such: Column A contains the dates for the month of November, Column B contains times that random instances occur, Column C is not important, Column E contains a Letter A-N that pertains to what occurred at a time in column B. SO, Column B and column E coordinate with each other.
Here is an example. Column A - Cell A1 - 11/01/2013 , A2 - 11/02/2013, A3 - 11/03/2013.
Column B - Cell B1 - 12:01 AM , Cell B2 - 14:03 , Cell B3 - 15:23
Column C - Cell E1 - A , Cell E2 - A, Cell E3 - B
So I would like Column F to display that between 12:00 - 12:59 Am there was X number of times the letter A occurred throughout the entire month.
I am using this formula to count the number of times “closed” appears between
particular dates:
=SUMPRODUCT(--($B$1:$B$23=F1)*($C$1:$C$23="Closed")*($A$1:$A$23>=$I$2)*($A$1:$A$23<=$J$2))
I have tried applying the same logic to another formula where I wanted to
Also count the number of times “Not Stated” and “In Progress” are shown.
However when I do I am receiving a ‘0’ number in return. The formula I wrote
was:
=SUMPRODUCT(--(CS_Ticket_Report_Dump!D$1:D$50000=C6)*
(CS_Ticket_Report_Dump!G$1:G$50000="Closed")*
(CS_Ticket_Report_Dump!G$1:G$50000="In Progress")*
(CS_Ticket_Report_Dump!G$1:G$50000="Not Started")*
(CS_Ticket_Report_Dump!A$1:A$50000>=AN$1)*
(CS_Ticket_Report_Dump!A$1:A$50000<=AO$1))
I have a filtered list and want to count the number of times each value appears in the filtered list. I also have other hidden rows that I do not want to include in the count and the filtered rows should not be included in the count either. I have tried countif, pivot tables and subtotal .
View 9 Replies View RelatedIs there a way that I can add up the ?
When I try to use IF formulas it is asking for text but I don't want it to look at text and just the color.
I need to count how many times I've got, for instance, "a" in several cells where I typed some text...
I would need a formula where I can indicate the letter I want and the range of cells where to look at, and having as result how many occurances there are...
If you are very good instead of a single letter, maybe a sequence of letters... but this is an extra!
