I want to count how many times a particular text appears in Column A depending on the number times another text appears in Column B.
Say for example if I have in Column A {A, B, C, D}nd column B I have {AA,BB,CC) and if I want to check how many times column A has "A" value when the column B has "CC" value, then how should I proceed with this ?
i have a spreadsheet where I need to count up how many times a particular phrase within a text string appears. The text string will be duplicated many times throughout the spreadsheet.
For example :
Miss X was at work on Saturday
Mr XX was at work on Saturday but not Tuesday
Miss Y was at work on Tuesday
So I would like to count up how many times "work on Saturday" appears in my spreadsheet, and then as a seperate query, how many times "work on Tuesday" appears.
I have a two ranges of columns containing names. I need to count how many times a specific name appears in ColumnN - Easy enough =COUNTIF(N$2:N$1047,Q3) ...Q3 being the name I am looking for.
Now comes the part I am stuck on. I need to count how many times a name appears in ColumnK but only if there is no name in ColumnN.
I tried =IF(COUNTIF(N3:N1047,""),COUNTIF(K2:K1047,T3),)
I want to count the number of times a word appears in a range (like M9:S663), but sorting it by the month it appears (eg: january = 2, february = 56, march = 2000, etc.)
I managed to do this but there has to be a better way
=COUNTIFS(RNM.1;"PRUM Transcripcion";FechaComite;">=01/01/2012";FechaComite;"=01/01/2012";
FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";
FechaComite;"=01/01/2012";FechaComite;"=01/01/2012";FechaComite;"
I have a few spreadsheets with a few land transactions. I want to see if the parties involved are male or female, or both (in case of joint titles). And how many. I've tried to use ISNUMBER formulas and COUNTIF formulas but I can't seem to make them work. I've attached an example of what I need to do, the original has many more column with more info, and the names are in a different language which makes it easier to identify as female or not (like 'phany' in english female names etc).
View 8 Replies View RelatedI have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2",""))
in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.
I an trying to count how many times the value "Adhesive/tapes" appears in col CV but only where there is a corresponding value of "Prat","Onsite" in col CV......
I thought that this would work but is returning a #Value error....
=COUNTIFS($AZ$1:$AZ$10380,"Adhesive/tapes",$CV$2:$CV$10380,{"Prat","Onsite"})
I am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter
View 2 Replies View RelatedI have a sheet set up to record free pour tests for my bar team.
Column A has the date.
Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names
Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.
What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.
I can easily count the names, but how do I count if they have pass or failed?
I've got a set of data that I update once a month and the number of team members per team changes all the time. I'm trying to write a formula that basically says, if the date matches AND the manager name matches, count the number of team members.
In the attached sample if A2 and B4 are found in the data set, count the number of SalesReps they have. So I'm looking at Sarah for February 2013, she has two sales reps that sold something, but Katherine appears twice, so I'm not looking for a result of 3, the correct answer is 2. How do I write the formula?
A2 will look to the data range of A14:A23 and SarahK will look to I14:I23, but I want to count H14:23.
i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?
View 8 Replies View RelatedWhat formula will count the number of times the value J3 appears in E2:E400. BTW...the a-g is formatted as a table. excel 07
View 3 Replies View RelatedI am using this formula to count the number of times “closed” appears between
particular dates:
=SUMPRODUCT(--($B$1:$B$23=F1)*($C$1:$C$23="Closed")*($A$1:$A$23>=$I$2)*($A$1:$A$23<=$J$2))
I have tried applying the same logic to another formula where I wanted to
Also count the number of times “Not Stated” and “In Progress” are shown.
However when I do I am receiving a ‘0’ number in return. The formula I wrote
was:
=SUMPRODUCT(--(CS_Ticket_Report_Dump!D$1:D$50000=C6)*
(CS_Ticket_Report_Dump!G$1:G$50000="Closed")*
(CS_Ticket_Report_Dump!G$1:G$50000="In Progress")*
(CS_Ticket_Report_Dump!G$1:G$50000="Not Started")*
(CS_Ticket_Report_Dump!A$1:A$50000>=AN$1)*
(CS_Ticket_Report_Dump!A$1:A$50000<=AO$1))
My Problem is I have a workbook with multiple sheets with a possibility of a number between 2 and 999 occurring. I am looking for a formula that can display a table on the "total" worksheet for every ID number that has been entered and the number of times the ID number is displayed.
View 7 Replies View RelatedI have number of items and many items appear more than once. I need a formula so that counts the number of item appearing maximum number of times and it displays the name of the text written NOT the number of times it is written. It should also calculate number of times it appears in a particular month.
For E.g.
Table 1-5-2012
Chair 1-5-2012
Fan 3-5-2012
Table 10-5-2012
Fan 1-6-2012
Window 1-6-2012
Glass 1-7-2012
Glass 9-7-2012
The formula should work as follows
Table 2 May-12
Glass 2 July-12
I am trying to use find and replace but the text that i'm searching for appears three times in the cell. I only need to replace the first occurrence in the cell. Alternatively, if there is a way to do this, can the second and third occurrence be changed?
Example:
Cheryl called Louie to advise she would be late for the meeting. Louie responded that he would meet Cheryl at her office. Cheryl confirmed.
I need to change the first 'Cheryl' to a job title and the second and third Cheryl to her initials (CL) so would read:
Manager of Aboriginal Affairs called Louie to advise she would be late for the meeting. Louie responded that he would meet CL at her office. CL confirmed.
A1:A10 contains text (say colors) and B1:B10 also text (say vegetables). I need a formula to count the number of times a certain combination of numbers and vegetables appear in the same column, so if "red" and "carrot" appeared in A4 and B4 and also in A6 and B6, the result would be 2.
View 4 Replies View RelatedRight now, I'm trying to find a way to count the number of times a certain phrase appears in a column.
I'm currently using this formula for exact values: COUNTIF(A1:A5,"Hello"), but this only works if an entry in a column is exactly: "Hello"
I want to be able to count a column even if it has more words, such as "Hello how are you" etc., and this column would be counted because it has the word "hello" in it.
I type random numbers into column B
I want cell E10 to read column B then display (number 26 for example) how many times number 26 appears in column B
I am trying to create a graph that is conditional on two different columns. The first column is a date column, the second column has various categories. I want to show how many times each category appears per month. This database is continually added to so I wanted the formula to reflect the entire column range.
For example, let say I have 5 categories (Grapes, Apples, Peach, Pear, Banana). Column A would show a date (in a M/D/Y format) and Column B would list the fruit type. I want to show how many Grapes were input in January, February, March, etc. and then move on to show how many apples in each month, and so on.
I have a single work book with 8 sheets (I am using Excel 2010 BTW) and I am trying to find a total of times a word appears across all the sheets in column "C"
I found this formula on another thread. =SUM(COUNTIF(INDIRECT("Sheet"&{1,2,3}&"!C1:C1000"),"="&H3)) with an example. I made the changes that I needed for my purposes
This worked but only after I renamed the sheets to Sheet1, Sheet2, etc.
Is there a way get the same results from the above formula if all the sheets are named after our reps? Example: sheet1 is named Dan, Sheet2 is Nick, etc?
I have a very large spreadsheet and want to count the number of times a particular text string shows up in a column. I can't use autofilter due to the 1000 limit.
Here's an example, Column C contains:
Dan Parker
John Doe
Dan Smith
Jill Smith
So if I search on *Dan*, the function should return a count of 2.
I've used COUNTIF before to return values when the whole cell = a certain value but in my case the cell may have 200 characters and I want to count based on a fuzzy search. I would like to do this in a function and not a macro.
I need to populate sheet 1 of the spreadsheet attached.
I have tried several formula's but don't work and am getting desperate!
I need to count Column A of sheet2, when "Adverse SEN" occurs but only when there is an "x" in Column B of sheet 2 appears next to "Adverse SEN".
So basically i need to populate Sheet1 of the spreadsheet with the data is sheet2 of the spreadsheet.
I need a formula to calculate how many time an adverse SEN was - where there is an x - resubmitted, approved at meeting, delegate approval obtained, approval outstanding, rejected or approval not required.
I am using excel 2003, so please don't provide me countif functions.
When I hide a column in this spreadsheet, text appears in some of the cells that shouldn't be there. When I highlight and try to delete, it won't delete and it doesn't even show up in the function bar. I was able to get it to delete when I do clear, all from the edit menu but as soon as I try formating the cell, it puts it right back. Same text, same formatting. I can't get rid of it.
View 10 Replies View RelatedI need to count how many times I've got, for instance, "a" in several cells where I typed some text...
I would need a formula where I can indicate the letter I want and the range of cells where to look at, and having as result how many occurances there are...
If you are very good instead of a single letter, maybe a sequence of letters... but this is an extra!
The attached spreadsheet is a sample of a master sheet I need to maintain. Keep in mind that the spreadsheet has hundreds of names on it and 10 sheets in the workbook. What name appears most in the "person who called" column, then I need to know out of all the people who called, what percentage of calls he made....
I have to do this on each sheet, so if it is possible to have it work for all the sheets.
At work I have been tasked with building a summary excel document that details people's names, grades etc. To be accurate, each person has their own positional code (a unique number), which I used in my lookup formula. After weeks of work, I have 1500 odd names down. However, this is 6 short of what I need the number to be. This is the cause of great stress,as this has to be ready on Monday, and I just don't have the time or sanity to sit there copying and pasting a number into find 1500 times to find the 6 numbers I have accidently ticked off as in the document. Therefore, it would be useful if there were some way to tell me how many times a number appears in the document. Each number should obviously appear twice (once in the data sheet, and once in the appropriate table)
View 9 Replies View RelatedI have 2 columns with data in them, basically representing a gaussian distribution. Column A has the "X-axis" values and so is uniformly ascending with no duplicates. Column B has the "Y-axis" values and increases up to a maximum and then decreases again (this is data from an instrument and so its not completely smooth but is close). An example is below.
0 4
1 8
2 16
3 27
4 50
5 27
6 16
7 8
8 4
What I would like to do is get the 2 Column A values where the corresponding column B value is half of the max (in the case above, 25 is not available so the closest is 27). I am trying to calculate the difference between these values, so in the example, I would have 5-3. Is there a way to do this?
I have a column A with names (let's say that we have four names: A, B, C, D) and a column B with dates.
I need a formula to count how many times appears a name in a column, for every single day (because in a single day a name may appear more than once).
Is this possible with a formula or I need to think at VB?
Im trying to construct a nested Countif statement. I need to count the number of instances that "Project" appears in Column O AND "TS" in Column N. The range is in another in Sheet2. and the summary in Sheet 1 where I want to have the Countif(AND...??? statement Example Counif(Sheet 1 Column 0 contains "Project" AND if Column N Contains "TS"
View 2 Replies View Related