I was hoping that my formula would give me the count number based on the Maximum time (latest time) and the Name field...My result is a 0 instead of 62 (the correct answer).
=SUM((Download!$H$2:$H$10=A4)*(Download!$D$2:$D$10=MAX(IF(Download!$H$2:$H$10=$A4,Download!$D$2:$D$1 0)))*Download!$I$2:$I$10)
Would a Index/Match/MAX function be more efficient?
Is there a way I can count the number of empty cells in a range, but up to 1 below a maximum, in this case a cell value?
For example, if the value of A1 is 10, I want to count how many blank cells appear between the range B1:B30 up to a maximum of 9, (1 below 10).
Look in Column E and find the MAX value. Once you find the MAX value, (let's say E27) display the date that's in C27. I bet this is really easy but I've been screwing around with it for over a half hour and can't get the correct result.
View 2 Replies View RelatedI have two columns of data. The first column is the 'type' and the second column is the 'value'. I need to find the maximum 'value' for each individual 'type'
The 'types' are not necessarily next to each other and the data cannot be sorted to do so.
Example:
type value
A 15
B 6
A 21
C 7
B 13
I need to be able to say the MAX for 'A' is 21, the MAX for 'B' is 13 and the MAX for 'C' is 7.
=INDEX(A1:F2,MATCH(MAX(A2:F2),A2:F2,0),1)
The desriptions are in a row in cells A through F
The values are in the cells below
I want to find the max value and return the description above.
I come up with the formula above, which is not giving me the correct answer. I get the answer of 5 as shown below.
ABCDEF
587135
5
I have trying to find the maximum date value in a series of campaigns with the same name [Combnined Campaign (Campaign)] , the aim is to pick the lowest version of the same name if the campaign is connected and pull the max end dates and number of weeks [Week Number Combined Campaign] that overall campaign has been running. A spreadsheet below explains this too.
What I need is to search for all the campaign names in column [Combined Campaign (Campaign)] and find the matching week number. What I am currently using is this formula:
=IFERROR(IF(E2="Yes",INDEX($A$1:$K$26,MAX(MATCH(F2,$G$1:$G$26,0),1),COLUMN($K$1:$K$26)),""),"")
Yet Max doesn't work with text.
Campaign Appeal Code
Launch Month
Market
Product
Combined Campaign (Yes/No)
Combined Campaign (Campaign)
Channel
Start Date
End Date
Week Number
Week Number If Combined Campaign
AAB13
Jan
Yes
AAB13
Mail
01/01/13
31/01/13
Complete
[Code] .........
I need a formula in order to find each time the maximum value.
View 3 Replies View Relatedhere is an attachment... i have found array fromulas for finding Maximum, Minimum & Median. Now i need to find the no of Maximum, Minimum & Median.
View 2 Replies View RelatedIs there a formula to count gaps? If you see the sheet below, I want to count maximum gaps in range A1:J12 and put that count in column L.
******** ******************** ************************************************************************>Microsoft Excel - Book2___Running: 11.0 : OS = Windows XP (F)ile (E)dit (V)iew (I)nsert (O)ptions (T)ools (D)ata (W)indow (H)elp (A)boutL12=ABCDEFGHIJKL1X XX XXX 22X X X 33 X X 64X X 85X X X X 26 X X 47 X X 48 X X 59 X X 610 1011 X X X X X 112X 9Sheet1 [HtmlMaker 2.42]
To see the formula in the cells just click on the cells hyperlink or click the Name box. DO NOT QUOTE THIS TABLE IMAGE ON SAME PAGE! OTHEWISE, ERROR OF JavaScript OCCUR.
I have a column with over 60,000 rows of data. I need to find out which value in the table occurs the maximum number of times, and its count.
The traditional methods of COUNTIF or INDEX/MATCH using MODE dont seem to work and excel crashes after a few mins.
Is there any other way to do the same (other than splitting the file into several smaller files)?
I have used max and min function to display minimum and maximum time value; however, it is not displaying the correct time value from the list. I think there is a better formula to achieve this. From the sample data displayed below, minimum time value should be 11:30PM and maximum time value should be 6:30AM
See sample data below:
4/1/2013 11:45 PM
4/1/2013 11:30 PM
4/2/2013 6:30 AM
4/2/2013 6:15 AM
4/2/2013 6:00 AM
4/2/2013 5:45 AM
[Code]....
I have the following formula C= day in DD/MM/YYYY and D = Time in HH:MM format and BJ5 is the date
View 3 Replies View RelatedDate Start End Total
12/8 - 2:00 3:00 = 1
12/8 - 4:00 5:00 = 2
12/8 - 20:00 21:00 = 5
12/9 - 23:00 0:00 = 3
12/9 - 3:00 4:00 = 4
=SUMIF($A:$A,">="&TODAY()-1,D:D)/24-SUMIF($A:$A,">"&TODAY(),D:D)/24
In the example above, E2 calculates the totals between 12/8 and 12/9 giving me 15:00. What I want the formula to exract is the total from Col D the total from 12/9 to the previous 24hrs.
12/8 has 2 entries, and 12/9 has 3 entries. The total I want to extract in 24 hours, NOT 1 day, is 14. What formula can I use that will calculate the totals in 24 hrs.
I have a sheet that lists customers in column A and then each customers Distribution & Sales over a period of time. The spreadsheet then flags if the customer has sold out in any month. I now require a count of maximum consecutive sellouts for each customer. For example:
Customer A S/O S/O nil nil S/O
Customer B S/O S/O S/O nil nil
Customer C nil S/O S/O S/O S/O
In the above example Customer A would have 2, B 3 and C 4 sellouts. I'm looking at about 10K customers I require for each product.
the macro will track daily min/max values, and keep a count of the times these values occurred in a separate sheet in the workbook.
At first I thought simply setting up a macro to look at a predefined range of rows to find the min/max values, but some days may be missing data; therefore, I need a macro with the logic that looks for the min/max value appropriate to each specific day (which is the tricky part). Below is the detailed explanation of the process.
1)The "Main" sheet, Column A, contains days 01/05/1999 – 01/29/1999 (days are already in numerical value format). Begin in A1 and this will be the first daily value. Find the Max Value in Column D corresponding to the numerical daily value of A1.
2)Once Max Value found in Column D, Column B of same row will have the time the Max Value occurred.
3)Count time Max Value occurred in “Time Count” sheet Column C of corresponding time.
4)Move down to next daily value. Continue this process to last row in sheet.
For example, “Main” Sheet, day 01/05/1999 (numerical daily value 36165), Max Value is 1.1835 found in Cell D12. B12 has the time at 2:45. A “1” is then placed next to 2:45 or C14 of the “TimeCount” sheet. If the next day’s Max Value occurred at the same time, then a 2 would be placed in C14...........................
I have an Array:
FALSE
TRUE
TRUE
FALSE
TRUE
FALSE
FALSE
TRUE
TRUE
my aim is to count the maximum occurrences in sequence of False statements before they are interrupted with a True ( in this case 2)
I can figure it out what method to use, Formulas or VBA? More precisely my VBA sucks I am trying to use excel functions by creating a counter with if() and then sum it but obviously it is a dead end.
NameTime InTime OutAlan08300930Alan10001030Alan12301630Tony11301230Alan09450950Tony10301115
I would like to find the minimum time in and maximum time out for each person. The data type of Time In and Time Out are general.
I.E
NameTime InTime OutAlan08301630Tony10301230
Therefore, I would like to know what function in excel will enable me to perform such task. Furthermore, can this function use with VBA?
Daily At the end of day We receive sales files from our different teams, these files are received at different times due to difference in working shifts. I have collated last one month data and from this data I want to know the earliest and maximum time and date on which we received the files in last month, so that i can fix the receiving time for all regions.
View 5 Replies View RelatedSo I have a workbook that has a range of dates in one column and a corresponding range of times in the column next to it. On a separate sheet I want to return the lowest time&date, and then the maximum time&date. I've tried a few different things but nothing is working.I tried this:
Code:
=MIN(B:B+D:D)
This didn't work for some reason. It did return a time, but it wasn't the lowest. The maximum wasn't even close.
Previously I was just doing the min/max of the date in one cell and then the min/max of the time in a different one, but obviously that didn't work since the time wasn't going off of the maximum date, so it was just showing the lowest time period.
I am using Excel 2003 and have a spreadsheet that lists 1521 fonts. I am using VBA and looping through the list of font names in column 1 and want to put an example of the font in column 2. I am trapping for error 1004 and using Resume Next. This works fine for 480 lines and then it just stops working. No error message or anything. The only thing I could think of is there might be a maximum number of fonts allowed per spreadsheete, but I would have though I would get an error.
View 3 Replies View RelatedI tried to Google this question but cannot find the answer. What is the maximum number of worksheets that Excel can hide within a workbook? I have a macro which hides all worksheets with the exception of the active worksheet and it has never failed. But this morning I had started working on a workbook containing many sheets and when I ran my HideSheets macro a maximum of 14 sheets hides every time. Is it my code (see below)?
View 2 Replies View Relatedhow to make vb Scroll Bar “Max” number to be equal to the next empty cell in column A in Sheet25. For example when A5000 cell is empty in Sheet25 then in Property of Scroll Bar Max setting would be 5000 and scroll bar must be at the position of max number.
View 4 Replies View RelatedWhat formula can i use to obtain the address of the cell which contains the highest number? My range is A:A
View 2 Replies View RelatedI've got a table where I want excel to generate the next number. With the following table excel must generate an invoice number (column B). I've got the formula to work correctly until a payment is done as shown in B12,B13 and B14. I need a formula to lookup the maximum invoice number (SC1-0007) and in cell B15 the serial number SC1-0008 must be shown. [URL]
View 1 Replies View RelatedThe content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
selecting a range under a condition. I'd like to write a macro to find the maximum value for a certain ID. The number of ID rows (left column) is unknown so can't say range("A1:A5"). Then have the ID and max number shifted to another column. Maybe use 'rows.count' ?
Eg.
4009 5
4009 9
4009 8
4009 4
4005 7
4005 3
4005 9
3008 10
3008 11
I've done some searching, but haven't been able to find a reference anywhere to:
what is the maximum number of criteria that autofilter will support?
I have been trying to determine the maximum/minimum value and additional count from a variable range which then I can use to subtract the first data of the range; I have been able to do that for a fixed range but not a variable one.
I have Column A with random positive numbers.
I have Column B with random negative numbers.
I have Column C with random numbers.
I have Column D with random numbers.
I have Column E with random 0’s and 1’s.
I have a set of 1600 cells of numerical data on each of the columns and there will be times when the random 0’s and 1’s from Column D will have appear repeatedly before changing to the opposite number, fx, I will get 7 nr. 1s before I get a 0 (zero).
I have been able to obtain the values in 2 cells within a fixed range:
If the last 8 cells in Column D have been “1” then I do:
F1=MAX(A1:A8)
G1=INDEX(C1:C8;MATCH(9.99999999999999E+307;C1:C8)) ---(Which provides the first number of the range in Column C after Column D has changed from 0 in D9 to 1 in D8)
H1=(F1-G1)
If the next 3 cells in Column D have been “0” then I do:
F9=MIN(B9:B11)
G9=INDEX(C9:C11;MATCH(9.99999999999999E+307;C9:C11)) ---(Which provides the first number of this range after Column D has changed from 1 in D12 to 0 in D11)
H9=(G1-F1)
Additional to this, the COUNT has also been challenging since I want to obtain in Column I, the COUNT of repeated 1’s from each range of 1’s in Column D; and also in Column J the same but for 0’s.
Fx:I18 (size of the range of 1’s originated from D1:D8)
J93 (size of the range of 0’s which consist to be the next range before 1’s were originated)
I12X (size of the range of 1’s which consist to be the next range before changed to 0’s)
However, that only works for a fixed range and continuous updates are made.
Book1.xlsx
I have two columns of data with a minimum value in the first column and a maximum value in the second column. What I'm trying to get is an indicator in a third column which tells me if a whole number falls at or between the minimum and maximum values. Here is a sample of my data:
A1 B1 C1
0 0.1 TRUE
0.2 0.5 FALSE
0.6 0.8 FALSE
0.9 1.2 TRUE
1.3 1.6 FALSE
1.7 2.0 TRUE
i'm looking to return the cell address of the max number in a given range?
View 3 Replies View Related