Specify Maximum No. Of Letters In A Cell?
I need to limit the number of letters that a person can write in a given cell.
View Complete Thread with Replies
Sponsored Links:
Related Forum Messages:
Find Maximum Number Of Letters
The content of Cell A1 looks like this attccggttaattcccccaaaattt (only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g. here the answer is 5 times and distance is 13 from start.
View Replies!
View Related
Column Letters- VBA Command To Get The Letters
Is there a VBA command to get the letters, instead of the numbers, of the column of a selected cell? I have to letter a list whihc means setting up a loop using character codes. I may have to go into double letters so I am working on how I would set up the loop for if and when it gets past 90 and starts on double letters. so far the highest is the letter "U" of course the easiest would be to pick up a column value as a letter NT values do not get a number A_____ _____NT### B_____1_______C#### C_____2_______RMK### D____ _______NT#### i am guessing the loop might involve some arithmetic test between the count and the character set 65-90. or maybe a mod thing.
View Replies!
View Related
Select First 7 Letters From A Cell
I have some code that loops through a sheet exporting each row to it's own file. The code below is the part that writes the file. The variable "i" is used to count which row the loop is on. I had planned to use the text in the first cell to identify the files, but the problem is that it contains some characters that cannot be used in Windows file names. So what I had hoped to accomplish was to just use the first 7 letters from each cell in column "a" in the filename. how to modify this to only take the first 7 letters from the cell instead of the entire cell contents? Set a = fs.CreateTextFile(DestFile & Cells(i, 1).Text, True)
View Replies!
View Related
Recognize Letters Before A Number In A Cell
I have the following column: A1 B1 B3 Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing AC125 1587 AF123 1365 AR125 1259 I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
View Replies!
View Related
Validate Cell Not Empty Or Certain Letters
I have a sheet which in a certain cell (H4) must contain either an "I", "J", "R" or "S" in upper case. The user fills in the sheet, and then a macro runs that does lots of things. I have been asked to put a bit of code at the start of the macros to validate the contents of cell H4. However it doesnt seem to work, particularly the isempty statement Sub SiteVal() ' ' SiteVal Macro ' If ("H4") = "S" Then Else If ("H4") = "I" Then Else If ("H4") = "R" Then Else If ("H4") = "J" Then Else If IsEmpty("H4") = True Then MsgBox "Site code must be input" Exit Sub Else End If End If End If End If End If ' End Sub
View Replies!
View Related
Return Maximum Of Active Cell & Arbitrary Value To Cell
I am looking for VBA that will add the value of the current active cell on the sheet to the value in cell F12. The maximum value of F12 cannot exceed 1000. So if the value in F12 = 950 and 100 is the value in the active cell the maximum value in F12 should show 1000, not 1050. It should do this on the click of a button.
View Replies!
View Related
Maximum Cell Value
In a cell, I would like to limit the maximum upper limit. For instance, in a cell with (=H23*0.06), that value ranges from perhaps 1.48 up to 5.93; however, I would like for the upper limit to stop at 3.33. Would that be conditional formatting? How can I stop the upper limit at 3.33?
View Replies!
View Related
Deleting The Units (letters) In Two Cell Ranges And Graph It
I would like to build a Macro to delete units (ex: 10V --->10) of two cell ranges that are not beside each other and eventually automate it to graph these two ranges because I will be running samples and have to produce a graphs for each sample. I tried the code below, but I can't figure out how to include 2 ranges without deleting letters in other cells in in between the ranges. for ex: I want to delete the non numerical characters in the two ranges C3:C1000 and H3:H1000 and graph these ranges.
View Replies!
View Related
Retrieving A Number Format From A Cell Grouped With Letters
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View Replies!
View Related
Maximum Characters Per Cell
I have a worksheet that multiple users will be entering in data, this information is then being used to pull into a form located on a sepearte worksheet within the workbook. One of the cells in the input sheet has the potential to have more characters than excel will allow. It is my understanding the maximum number of characters per cell is 1,024. What is the best way to setup my spreadsheet in the event the data contains more than 1,024 characters. The informatino going into the cell are legal descriptions of property so I want to be able to keep the description together in the final document in the other worksheet. Is there a way the user can input the entire decription in one cell, regardless of the character size, then have a formula to take the first 1,024 characters and put them in one cell, followed by another formula to put the next 1,024 characters in the next cell? Then in my main document I would use the concatenate formual to combine these two cells into one.
View Replies!
View Related
Cell Of Maximum Value In Another Column
I have a problem looking up the cell at which a maximum value in a curve is located. I have attached a workbook with an example of my problem (this is scaled down to limit the size of the attachment – my usual string of data is 5000 rows long). Column A is the time and all subsequent columns will contain force values (as shown in columns A and B) which create a similar sharp curve. Ideally I need to be able to lookup the time point (column A) at which the maximum force value occurs for each curve or if this is not possible the row number in which the maximum force value occurs. I would like to be able to do this using a formula rather than a macro if that is possible? I have tried using a number of excels lookup functions and read through the examples on the site but have had no success.
View Replies!
View Related
Finding The Cell Address Of Maximum Value
I have a range of overtime data. I want to list the maximum occurrence of first 10 overtime data ( Like 3200,2950.2300....etc) Thereafter from the results obtained I need to know the cell address of the employee corresponding to the results obtained, i.e XYZ, ABC..... A B Employee Name OT Amount 1. XYZ 3200.00 23. ABC 2950.00 35. WER 2300.00
View Replies!
View Related
Determine If Cell Maximum In Range
I have a spreadsheet where I need to check if one cell value is greater than 6 other cell values in the row, then have it enter 1 in another cell if so. For example: C1=5 C2=2 C3=3 C4=2 C5=7 C6=0 C7=4 The largest value is in cell C5, so I would like C6 to show that it is by entering a 1 in there.
View Replies!
View Related
Determine Cell Above Maximum Value Of Row
[TABLE] item01/11/200702/11/200703/11/2007 a1710 b2611 c359 [/TABLE] I have the above table. I would like to determine which is the item that has Maximum value on a particular date. example on 2/11/2007, the maximum value is 7, so the result should be item a. How can I achieve this by using a formula.
View Replies!
View Related
Return Cell Address With Maximum Value
I have two columns of numbers in column A & B. In column A I am trying to locate the maximum value and get the cell address of the number next to it in column B. I am currently using this formula to do this ..... =ADDRESS(MATCH(MAX(A1:A4),A1:A4),2,4) It works ok, but if the maximum number is the first value in the column it is returning the last cell address in column B. I am not sure what I am doing wrong.
View Replies!
View Related
Offset Cell From Found Maximum In Range
I recently asked how to locate a max value within a variable range using a macro and got the following responses: Get Maximum Value From Graph / Chart, all of which worked great. Dim r As Range Set r = Range("D2", Range("D50")) Range("K1").Value = Application.WorksheetFunction.Max(r) Range("Max1") = Application.WorksheetFunction.Max(ActiveChart.SeriesCollection(1).Values) Start = "D24" Finish = "D163" Range(Start, Finish).Select myrange = Selection.Address Range("Max2") = Application.WorksheetFunction.Max(Selection) Now I would like for a different cell to return the time value located one column to the left of the max value found above. I've tried to adapt other offset formulas that I've found to my purposes and haven't been able to make it work. how to do that using the max value as it is found in any of the above three ways
View Replies!
View Related
Find The Maximum Value In One Column And Retreive The Name Of Cell In Corresponding Row
I spent couple of hours trying to figure this out, but without success. Please check the attached example. I need a formula that will find the max value (number of views in English anguage) in the column "I" and display the corresponding "Headline" value in the column "B". In the example it is "Headline 5". I can not change position of the columns, i.e. "B" must remain "B" and "I" must remain "I". I experimented with Index and vlookup but to no success. I have outlook 2003.
View Replies!
View Related
Force New Active Cell When Maximum Number Of Characters Is Reached
We have a form that requires descriptive comments to be entered into several rows of merged cells. My goal is to have the form be able to automatically dropped down to the next row of merged cells when the current row of merged cells reaches a maximum number of characters. And finally, the last row of merged cells would not allow any more characters than the maximum assigned but not advance to another cell automatically. The rows I am working with specifically are: Merged Cells F23:R23; A24:R24; A25:R25; A26:R26;...A29:R29
View Replies!
View Related
Copy/Fill Down Formula To Maximum Row Of Last Cell In Columns
In a worksheet I retrieve data from a SQL query. Now I have to add 5 different calculations per row and each calculation will be stored in a new cell (so 5 columns will be created) I want to do this with a loop macro and calculate this till the last "filled" row. The number of rows differs every month. What loop code should I use and can somebody give me an example of the VBA code. Note that some formulas contains nested If-functions.
View Replies!
View Related
Capital Letters
I have a validation drop down box type thing... when I select the drop down, the lower-most option is highlighted as a default. How do I make it so that the upper-most option is highlighted first?
View Replies!
View Related
Letters In Sequence
I would like to create a column with letters from alphabet in a sequence. If I write A and in cell below I put B then highlight the two cells and drag down I get a repetition of A and B. How do I get the following alphabet letters ie. C,D, E etc.?
View Replies!
View Related
Extract First Three Letters
How would i extract the first 3 letters of the first 2 words in a cell? the cell may have 1 to many words in it. I would like to exclude words like of and the... i.e. the univeristy of washington should be uniwas
View Replies!
View Related
Alphanumeric Letters: C-A = 2
I have a few columns of letters (ranging from A to Z) - onyl one letter per cell. I need to be able to deduct them such that they result in a numeric difference (ie D-B=2, D-A=3). Is there any way this can be done in VBA? (The actual columns are in a word table, so would be great if there was a VBA way to do this, not an excel function).
View Replies!
View Related
Letters To Numbers
This formula will add up the letters D,N,H with one value Like =SUM(COUNTIF(B4:AZ4,{"D","N","H"}))*12 will =36 How can I add bN =17 bmN =19 bD=24 =SUM(COUNTIF(B4:AZ4,{"bN","bmN","bD"})) to add up to 60
View Replies!
View Related
Use Letters Corresponding To Value In Formulas
I'd like a function that converts a letter to a numerical value and returns a mean score for those values over a range. The values for each letter are: A*100 A90 B70 C50 D40 E30 F20 G10 U0 So in the range G4:AB4 there could be 3 letters (G4:I4) A* F E - their numerical equivalents in the table above = 100 + 20 + 30 = 150. The mean score for this range and expected output = 50 (150/3) I have enclosed a sample spreadsheet. The range of grades that needs calculating is G4:AB4. Expected output should be in AC4.
View Replies!
View Related
Using Letters In An Auto Number
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form": Count_Row = 1 DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000") 'To identify the next blank row in the database sheet For Each DBRECORD In DATABASE_RECORDS If DBRECORD <> "" Then Count_Row = Count_Row + 1 RowNum = Count_Row X = RowNum - 1 Sheets("Users").Range("A1" & RowNum) = "U000" & X Next DBRECORD This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
View Replies!
View Related
Counting Captial Letters
this topic is semi-related to to the link below..its not need to look at it..its just for reference. basically in this topic i just need help condensing the formula in cell "C18" it just counts the capital letters in cell "B18" http://www.mrexcel.com/forum/search....archid=1894488 Sheet7 ABC18Micheal Johnson JonesM. J. J. 319United States of AmericaU. S. A. 320Laugh Out LoudL. O. L. 3 Spreadsheet FormulasCellFormulaB18=init(A18)C18=LEN(B18)-LEN(SUBSTITUTE(B18,"A",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"B",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"C",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"D",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"E",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"F",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"G",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"H",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"I",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"J",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"K",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"L",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"M",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"N",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"O",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"P",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Q",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"R",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"S",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"T",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"U",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"V",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"W",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"X",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Y",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Z","")) Excel tables to the web >> Excel Jeanie HTML 4
View Replies!
View Related
Using Autofill Handle For Letters
How can i use the Autofill handle for letters? I want to be able to do the following: In cell A1 i type: A In cell A2 i type: B Then i want to use the handle to get in column A the rest like C D E....Z AA AB AC.......AZ BA BB BC etc.
View Replies!
View Related
Pulling Out UpperCase Letters
Is there a way to find and pull out uppercase letter in a cell.. Example Below! Sheet7 AB18Micheal Johnson JonesM. J. J.19United States of AmericaU. S. A.20Laugh Out LoudL. O. L.21North Dakota N. D. Excel tables to the web >> Excel Jeanie HTML 4 I'm Using Windows Xp Home Edition With Sp2 With Excel 2003!
View Replies!
View Related
Search For Letters Within Text
I have a list of global e mail addresses which are listed as Joe Lewis/NL/BNRO/NL Rocky Balboa/BR/BNRO/NL What i need to do is to highlight any name that has the letters BR,UY,or PY after the first back slash, so in this instance Rocky Balboa needs to be highlighted
View Replies!
View Related
|
TRACKER
