I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies View RelatedIn the given example below how can i recognize the last number which is LV-00010 and after recognizing the last number i wanted to add 1 so the next number will be LV-00011 (im using this as an automatic ref. no.).
LV-00007
LV-00004
LV-00010
LV-00008
LV-00009
LV-00001
LV-00002
LV-00006
LV-00003
LV-00005
How can I make excel to recongnize this: 123456- as a negative number?
View 7 Replies View RelatedBasically I have a phone number in column A:
123-456-1234
In column B, I want it to show me the first 3 numbers from the left, (so 123)
So I do =LEFT(A2,3)
Which gives me 123, but it's displayed as text, which ruins my whole formula that looks up the area code and displays the state.
I googled the problem and found http://exceltip.com/st/Make_LEFT_Fun...umber/778.html
which tells me to do:
=IF(LEFT(A1,1)=1,"Ignore",A1) [sees 1 as a number]
=IF(LEFT(A1,1)+0=1,"Ignore",A1) [sees 1 as a number]
=IF(LEFT(A1,1)="1","Ignore",A1) [sees 1 as text]
but when i try that it just displays the ENTIRE phone number: 123-456-1234
I'm trying to figure out a formula to be able to look at a column of txt and if it finds the word total it need to output the number at the column next to it. If the word total isnt in the text then it should leave it blanks (see below). Basically I want a column that pulls only the totals amounts in the column.
Aaron Drielick 3
Aaron Drielick 2.5
Aaron Drielick 37.5
Aaron Drielick Total 151.0
Akila Subagaru 31
Akila Subagaru 1.5
Akila Subagaru 1
Akila Subagaru 1.5
Akila Subagaru Total35.0
Albert Major 4
Albert Major 6.5
Albert Major 2
Albert Major 19.5
Over the weekend I had to look at 220 strings of numbers, some strings with as much as 20 numbers and determine if the numbers represented red, green, blue, or yellow and how many of each color from a parent list.
I did it all by hand. After getting help here from JBeaucaire on my tally sheet, which I successfully recreated with their guidance, I thought I might ask this question. How would one go about creating a macro that would when it seen a certain number, it would put the color in the column immediately to the left, and the number of colors in the column immediately to the left.
I'm trying to make a table of the total amount of a liquid used throughout the day. Here is what I am trying to do: In cell D4, I want to be able to enter something similar to the following: 3cup+2bottle+1liter
and by doing so, Excel can automatically recognize that 1cup is 8oz, 1bottle is 17oz, and 1liter is 34 oz because of the reference chart provided on the side. Also, it would be able to notice the 3, 2, and 1 amounts so it would multiply accordingly so it would know to do this: (3*8)+(2*17)+(1*34)
and then put the calculated amount in the cell. The correct answer should be 92oz. Is there a way for Excel to recognize the conversions (i.e. whenever it sees 'cup' it will multiply by 8) and multiplication factors (i.e. 3, 2, 1)?Is there a formula I can enter that I can just "drag" down to the upcoming days in column D?
I know I can just do something like this: (3*G4)+(2*G5)+(1*G6).
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
In cells A1:A3 I have:
(as text)
Cell Values Formula Needed
0100 01029250 FALSE
0100 01029304 FALSE
0100 REHAB01 TRUE
I need a formula in Cells B1:B3
to Recognize is a cells has characters A-Z
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
I need to use conditional formatting to recognize blank cells meaning totally blank and not cells with formulas returning 0 what i must use to get this result?
View 9 Replies View RelatedI have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
I am trying to use the codes below to find text "xmxy" and "xmx" within a column, then try to move the cells between the texts to the right by one column. I believe that the problem for the code below is that
Cells(j, "B").Insert (xlShiftToRight)
or If Cells(i, "B").Value = "xmxy" Then has limitations. I read that when you dim a variale as integer, it only can contain value between -32,768 to 32,767 . But I have more than 32,767 rows of data. I have already set dim i,j, etc. as long, but how do you set the cells range to recognize number larger than 32,767?
Sub ShiftRightbbb()
Dim i As Long, j As Long, lastrow As Long, rowscount As Long, count As Long
lastrow = Range("b" & 65000).End(xlUp).Row
For i = 1 To lastrow
If Cells(i, "B").Value = "xmxy" Then
For j = i To lastrow
Cells(j, "B").Insert (xlShiftToRight)
If Cells(j, "C").Value = "xmx" Then GoTo Nextgroup
Next j
Nextgroup:
End If
Next i
End Sub
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies View RelatedI have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies View RelatedScenario:
Column A = Row Description
Column B = Control value
Columns C-V = Time in Months
Row 1 = Months
Row 2 = Initial Values to find if >0
Cell B4 = Assumption of 18 months
Cell B6 = Value of 250 to insert if TRUE
In Cell C2 (January) I have a value that is 12
For example purposes I have an If formula in T3 (which is 18 months in the future. The formula is: =IF(C$2>0, $B$6,0). The result should be 250.
What I am looking for is a formula that will allow me to change Cell B4 to any month I want and still recognize if any cell in Row 2 is >0 then 250 (B6). All of row 3 should be filled with the same formula.
Options:
This could be a match if >0 then edate to column that has value >0, at 18 (B4) periods out.
i have encountered a problem which happens when you write data that contain : in an excel sheet (i use excel 2010)
for instance if i enter to one of the cell 45:58 excel sees it as 01/01/1900 21:48:00 when i try to get the information by using a function i will get the wrong data for example typing in the different cell LEFT(Cell,5) will result 1.908
(i receiving the data from an outside source in this way and i need to make analysis)
i have noticed that the first 2 digits (21 in the example) are related to the number i have choosen in a 24 hour cycle for instance
24:58 will result 01/01/1900 00:58:00
26:58 will result 01/01/1900 02:58:00
48:58 will result 02/01/1900 00:58:00
I'm working with text cells I get this tiny indent on the left hand side of a cell about the size of one hit of the spacebar button.
Excel doesn't recognise this as an indent and I can't get rid of it. It's, pardon my french
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
i have a list of 2000 fields which have the same format IE "AB10014"
I need to remove the "AB" from every field and leave the #.
Besides putting a space and running text to columns I'm not sure how.
I have words in cell range (i.e. A1:A1000) and I want them to became upper letters.
Excel forum to EXCEL FORUM
