Count The Number Of Different Letters Within A Cell
Jul 5, 2007ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
ADVERTISEMENT
Count Number Of Certain Letters In Given Cell
Mar 1, 2013I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
Using SUMPRODUCT To Count Certain Letters In A Cell?
Jun 4, 2014I am trying to use SUMPRODUCT on one of my excel files. the condition is that it will try to count all those cells that contain certain letters. i tried using this formula, =SUMPRODUCT(--('All Computers'!$A$2:$A$100000="USA*"),--('All Computers'!$E$2:$E$100000="June")), but I am getting a 0 value.
View 3 Replies View RelatedAssign Values To Letters And Count Total In A Cell
Feb 21, 2012Is it possible to assign values to letters (eg. a=1, b=2, c=3... z=26) and then count the total sum of those letters in a cell
Example
A1= car
car is c=3 + a=1 + r=18 which would make the total to be shown in A2 3+1+18=22
With this code i would like to create a subtotal of all letters per row and a batch total of the column with subtotal.
Recognize Letters Before A Number In A Cell
Mar 9, 2007I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
Counting Number Of Specific Letters In A Cell?
Sep 11, 2013I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
Retrieving A Number Format From A Cell Grouped With Letters
Apr 20, 2006i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies View RelatedCount Letters In Range
Jul 20, 2009I have a sheet that has various data in the range of cells from B1 to Q80.
In these cells are various letters, numbers, etc. In some cells, the letter "L" appears not at all, sometimes once, sometimes multiple times.
I need a formula (or another method), that counts the number of times "L" appears in the range of B1 to Q80 (and not outside this range). Unfortunately, COUNTIF wont do the trick since sometimes in a single cell, "L" appears multiple times and would get counted only once.
I prefer a formula, because I have to do the same thing for the letters D, H, O, M, C, U, K.... I figure I could just copy/paste and modify slightly for each letter I'm trying to count the instances of. Unless of course there's an easier method.
Count Letters In Cells
Feb 18, 2010I have a spreadsheet filled with either "B" or "S" in cells. Its 500 rows long (starts from row 2) and its 839 columns wide, but the cells begin to be filled with B and S after column 11. I would like to count all B's and all S's in each column, and add them....it works for B;s as it counts them up and spits the result in row 503, just as it is supposed to. But the counter for S, does not work.
View 4 Replies View RelatedCount Letters From Words
May 25, 2007i can count how many "A" there is in a text put in 1 box and "B" to be put in another box etc.
View 9 Replies View RelatedCount Cells By Number & Add Adjacent Cell If Number Is X
Jan 19, 2008Create some sort of formula combination or macro that will: Recognise a cell with a value of 1, 2 or 3 in. If 3 is in the cell, the cell to its left will be counted and added to a total. If the cell that has 3 in changes the value is removed from the total. Ive tried lots of methods but i cant figure this one out!
View 6 Replies View RelatedUsing Letters In An Auto Number
Apr 16, 2006I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
Find Letters In A Reference Number
May 6, 2009I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
Matching Set Pattern Of Letters And Number
Dec 12, 2013I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
Find Maximum Number Of Letters
May 27, 2009The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
Convert X Digit Number To Letters
May 11, 2008Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
Creating Complicated Formula With Letters And Number
Apr 8, 2014I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
How To Sort A Column Depending On Number Of Letters
Apr 15, 2008i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
Add Letters To Unique Random Number Macro
Mar 31, 2014Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
Add Number According To Count Of Cell Value
Dec 19, 2006Want to know what is the forumla for my case?
A B C
APPLE 3 APPLE=5
ORANGE 2 ORANGE=2
APPLE 2
I have data of column A and B. When A column is the same of a kind then add B and output the answer to C1.
Verify A Postcode Format That Starts With A Number Followed By One Or Two Letters
May 5, 2009How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies View RelatedFilter Out Letters Put In After A Number In A Time Card Spreadsheet
Jan 14, 2009I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies View RelatedCount Number Of Times A Certain Cell Changes?
Aug 5, 2007I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.
View 9 Replies View RelatedCount The Number Of Occurrences In Cell
Feb 16, 2007=SUMPRODUCT(--('2007'!$E$2:$E$500=$A$20),--('2007'!$O$2:$O$500=G2))--('2007'!$AA$2:$AA$500='2007'!$AA$3)
I need to count the number of occurrences in cell AA3. I need only to count the occurrences of AA3, that also have the contents of A20 and G2 in them.
Count Number Of Characters In Cell
Oct 18, 2006I need to do a macro to do this:
Count the numbers of the characters in a cell.
The number of characters must be appear in another cell.
This number must be refresh when you type the key, not when you push enter.
Count Number Of Numbers In A Cell
Jun 11, 2007I have a cell content to interogate in vba, the format of the cell
is that it has a set of numbers. There are 3 posible scenarios.
1 There is no number at all
2 There is just one number
3 There could be theoraticaly as many as 24 numbers separated by a space eg 2 4 12 .
I would like to count the number of these numbers and and express it as a variable. The numbers will always be unique by that I mean there will not be 2 same numbers in the one cell. I tried looking for the solution but I had no success.
For the example above TheFinalTotal = 3
Also Im trying to strip a date in a format 02/12/2006 into just 02122006. I know that this is possible but I just bomed out trying to find this as well.
Percentage Of Cell Value To Number Count
Jun 5, 2008I know for some of you this will be pretty simple but im having trouble figuring it out. Attached is a shortened version of what i am trying to do. I want the Percent Attendance column to represent the cumulative percentage(hope I used the correct phrase). So for Person 1, it should currently say 100%, person 2 it should say 66.67% and so on. There are 5 days that i want to get the percentage, but because we haven't gotten to 2 of them yet, using a regular sum formula for the entire five days gives me the wrong values.
View 2 Replies View RelatedVBA To Count Cell Value And Paste Cell Value And Number In Another Sheet
Jun 16, 2014Sheet("Dump1") has a series of data in duplicates in column E.
E.g. Pending Client
Pending Client
Pending Third Party
Pending Employee
Pending Third Party
Pending Client
And any other dynamic Comments.
I am trying a VBA which would count the serious of occurrences and paste the value with its name in Sheet("Status") Column A13 and below.
Like.
Pending Client 3
Pending Third Party 2
Pending Social 1 ( If it founds in data )
I cannot use the formula here to count, because I am not sure what all pending status will be there at given point of query.
Comparing Two Column For Matching Number But The Items Compared Also Contains Letters
May 2, 2006I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
Get Cell To Display As 1 (count) If Number In Column Is Above 90
Jul 31, 2014I have one collum with number ranging from 0-1000 in. I have another collum titled "above 90".
How do I get the "above 90" collum to display as 1 if the number in the other collum is above 90?
I understand it must be some kind of "COUNTIF" function but not sure...
