Count Most Freqently Occuring Number(s) In A Cell

Apr 26, 2007

I'd like to count the most frequently occuring value in a cell. That's it basically.

Say you have the following (actual extract) in a single cell

17,18,58,59,18,59,1,2,3,4,5,6,7,8,9,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38, 39,40,41,42,43,44,45,46,47,48,49,50,16,18,23,49,54,59,62,18,59

What formula can I use to show that the most commonly occuring value appearing is 18? [Possible values are 10 through to 99].

The source data for this is in fact a single row accross 5 columns and I concatenated it thinking that made things easier.
The original:

B11: 17,18,58,59
C11: 18,59
D11: 1,2,3,4,5,6,7,8,9,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44, 45,46,47,48,49,50
E11: 16,18,23,49,54,59,62
F11: 18,59

Ideally the formula should take this (B11:F11) range as it's input (I can then spill it down 50-odd rows)

ps I have tried the following

=INDEX(B11:F11,MATCH(MAX(COUNTIF(B11:F11,B11:F11)),COUNTIF(B11:F11,B11:F11),0))

Unfortunately though the internet tells me this should work, the result I get back is 18,59 which is wrong because:

18 occurs 5 times
59 occurs only 4 times

View 9 Replies


ADVERTISEMENT

Count Most Frequently Occuring

Dec 2, 2006

I have a list of numbers in an Excel range. Most of the numbers are the same but some are not. I need a function that will go through the list and return the value which occurs most frequently. (Not the number of occurences but the actual value). I need to do this in VBA.

View 3 Replies View Related

Get Value Occuring Maximum Times And Its Count

Aug 14, 2009

I have a column with over 60,000 rows of data. I need to find out which value in the table occurs the maximum number of times, and its count.

The traditional methods of COUNTIF or INDEX/MATCH using MODE dont seem to work and excel crashes after a few mins.

Is there any other way to do the same (other than splitting the file into several smaller files)?

View 9 Replies View Related

Count Most Frequently Occuring Word

Dec 25, 2006

I know the mode function finds the most frequently occuring number but is there a way to find the most frequently occuring word/text?

View 3 Replies View Related

Count Maximum Occuring Rows Of Duplicates

Nov 29, 2006

I have an Array:

FALSE
TRUE
TRUE
FALSE
TRUE
FALSE
FALSE
TRUE
TRUE

my aim is to count the maximum occurrences in sequence of False statements before they are interrupted with a True ( in this case 2)

I can figure it out what method to use, Formulas or VBA? More precisely my VBA sucks I am trying to use excel functions by creating a counter with if() and then sum it but obviously it is a dead end.

View 3 Replies View Related

Count Cells By Number & Add Adjacent Cell If Number Is X

Jan 19, 2008

Create some sort of formula combination or macro that will: Recognise a cell with a value of 1, 2 or 3 in. If 3 is in the cell, the cell to its left will be counted and added to a total. If the cell that has 3 in changes the value is removed from the total. Ive tried lots of methods but i cant figure this one out!

View 6 Replies View Related

Add Number According To Count Of Cell Value

Dec 19, 2006

Want to know what is the forumla for my case?

A B C
APPLE 3 APPLE=5
ORANGE 2 ORANGE=2
APPLE 2

I have data of column A and B. When A column is the same of a kind then add B and output the answer to C1.

View 5 Replies View Related

Count Number Of Times A Certain Cell Changes?

Aug 5, 2007

I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.

View 9 Replies View Related

Count Number Of Certain Letters In Given Cell

Mar 1, 2013

I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.

Here is my formula.

=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")

View 1 Replies View Related

Count The Number Of Occurrences In Cell

Feb 16, 2007

=SUMPRODUCT(--('2007'!$E$2:$E$500=$A$20),--('2007'!$O$2:$O$500=G2))--('2007'!$AA$2:$AA$500='2007'!$AA$3)

I need to count the number of occurrences in cell AA3. I need only to count the occurrences of AA3, that also have the contents of A20 and G2 in them.

View 9 Replies View Related

Count The Number Of Different Letters Within A Cell

Jul 5, 2007

ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.

View 9 Replies View Related

Count Number Of Characters In Cell

Oct 18, 2006

I need to do a macro to do this:

Count the numbers of the characters in a cell.
The number of characters must be appear in another cell.
This number must be refresh when you type the key, not when you push enter.

View 6 Replies View Related

Count Number Of Numbers In A Cell

Jun 11, 2007

I have a cell content to interogate in vba, the format of the cell
is that it has a set of numbers. There are 3 posible scenarios.
1 There is no number at all
2 There is just one number
3 There could be theoraticaly as many as 24 numbers separated by a space eg 2 4 12 .

I would like to count the number of these numbers and and express it as a variable. The numbers will always be unique by that I mean there will not be 2 same numbers in the one cell. I tried looking for the solution but I had no success.

For the example above TheFinalTotal = 3

Also Im trying to strip a date in a format 02/12/2006 into just 02122006. I know that this is possible but I just bomed out trying to find this as well.

View 9 Replies View Related

Percentage Of Cell Value To Number Count

Jun 5, 2008

I know for some of you this will be pretty simple but im having trouble figuring it out. Attached is a shortened version of what i am trying to do. I want the Percent Attendance column to represent the cumulative percentage(hope I used the correct phrase). So for Person 1, it should currently say 100%, person 2 it should say 66.67% and so on. There are 5 days that i want to get the percentage, but because we haven't gotten to 2 of them yet, using a regular sum formula for the entire five days gives me the wrong values.

View 2 Replies View Related

VBA To Count Cell Value And Paste Cell Value And Number In Another Sheet

Jun 16, 2014

Sheet("Dump1") has a series of data in duplicates in column E.

E.g. Pending Client
Pending Client
Pending Third Party
Pending Employee
Pending Third Party
Pending Client
And any other dynamic Comments.

I am trying a VBA which would count the serious of occurrences and paste the value with its name in Sheet("Status") Column A13 and below.

Like.
Pending Client 3
Pending Third Party 2
Pending Social 1 ( If it founds in data )

I cannot use the formula here to count, because I am not sure what all pending status will be there at given point of query.

View 4 Replies View Related

Formula: Return Most Frequently Occuring Value

Nov 21, 2006

I am given a database of 292 cells and i am asked to calculate the mode. How can i do it?

View 9 Replies View Related

Probability Combinations Of Events Occuring

Dec 4, 2006

I need a probability distribution for amounts to be shipped taking into account both the probabilty distribution on parcel sizes (amounts to be shipped) per ship as well as the probabilities on the number of ships arriving.

Please see the following:

Say you have a probabilty distribution for ships arriving, i.e. the probabilty of 1 ship arriving in a specific time period= 0.25 ( event a), the probabilty of 2 ships arriving = 0.2 (event B) etc. Please take into account that this can go up to about 20 ships per time period.

Each ship can have one of four parcel sizes, (demand that needs to be met) (the following are just example probabilties)

0 tons with a probability of 0.67 event 1
1000 tons with a probabilty of 0.08 event 2
1500 tons with a probabilty of 0.222 event 3
2000 tons with a probabilty of 0.022 event 4

Thus event a has a probabilty of occuring, in event a, events 1to 4 can occur with their respective probabilties.

I assumed events 1 to 4 stay the same for all ships arriving (as we are dealing with multiple products, each product will have different parcel size distributions, however I look at products seperately, thus only one product is considered here)

This is simple for 1 or 2 ships, but as the number of ships increase the number of combinations become excessively large.

Should i use a macro that determines permutations/combinations? I am kind of clueless on this one.

If it helps to put the problem in context; I am trying to determine a demand distribution as input for a stochastic programming model

View 7 Replies View Related

Get Cell To Display As 1 (count) If Number In Column Is Above 90

Jul 31, 2014

I have one collum with number ranging from 0-1000 in. I have another collum titled "above 90".

How do I get the "above 90" collum to display as 1 if the number in the other collum is above 90?

I understand it must be some kind of "COUNTIF" function but not sure...

View 7 Replies View Related

Count Of Specific Number In Single Cell

Feb 13, 2008

I have a spreadsheet which has a column that contains route numbers (for collection of goods). Some addresses have 2 or 3 route numbers within the same cell i.e.

3
3 20
3 20 15

I would like to know the formula for counting the number of cells that contain each route number i.e. from above 3 = 3, 20 = 2, 15 = 1

View 5 Replies View Related

How To Count The Number Of Words In A Cell With Line Breaks

Jun 6, 2014

I am making a content database and need to count the number of words in each cell...

I know you can count them with

=IF(LEN(TRIM(A2))=0,0,LEN(TRIM(A2))-LEN(SUBSTITUTE(A2,” β€œ,””))+1)

but the the cells have line breaks so this formula won't work

I've understood that since there is a space before the new line, the formula will not recognise the space and therefore not recognise a new word.

View 11 Replies View Related

Count Number Of Times Letter A Appears In Cell?

May 31, 2014

i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?

View 8 Replies View Related

Count Number Of Cells Between Recurring Cell In A Column

Aug 15, 2012

code that will count the number of cells under a "title cell" that is recurring in a column, and then divide the result by 2. The result will then be displayed in another column preferably aligned to the "title cell" (in this case "Items") in column A.

For example:

Before code is applied

A1: Items
A2: Items
A3: four-legged
A4: dog
A5: two-legged
A6: chicken
A7: Items
A8: four-legged
A9: cat

[code]....

After code is applied to column A

A1: Items B1: 0
A2: Items B2: 2
A3: four-legged
A4: dog
A5: two-legged
A6: chicken
A7: Items B7: 1
A8: four-legged
A9: cat

[code]....

View 9 Replies View Related

Count The Number Of Multiple Values In A Single Cell

Jan 28, 2010

formula that will return the number of "x"s or "o"s within the same cell.

The cell has values that are formatted in multiple ways for example: PXX--XXP, --XO, OXX--.

I want the formula to return 4 if the cells has PXX--XXP or 3 if the cells has --OXX etc.

View 9 Replies View Related

Count/Average Number Of Specified Name Where Corresponding Cell Is Not Blank/Empty

May 1, 2008

sumif problem but it wont work with a countif or average if.

Column A has various names and Column B has amounts, what I need is to count the number of occurances "John Smith" has an amount in Column B. The previous formula I tried was

=sumif(A:A,"John Smith",B:B) but with either countif or averageif it errors too many arguements.

I wasn't sure if Dcount or an array would be suitable but have not used them before.

Pivot tables I'm sure will be the future with this but haven't got to the foot of that mountain yet.

View 4 Replies View Related

Count Number Of Lines (Wrap Text) In Cell

Jun 11, 2008

I need to count the number of Carriage returns in a string of text in a group of merged cells also I need to add a carriage return after the 1024 character because I have the wrap text on. My overall goal is have copy text fit into a group of merged cells without any being cut off by excel.

View 4 Replies View Related

Macro Or Formula To Find The 2 Most Frequently Occuring Numbers

Mar 21, 2009

I need to know from the combinations below which are the 2 numbers that appeared the most. Example....

View 4 Replies View Related

Ignoring Blank Cells/commonly Occuring Text

Feb 14, 2007

1. First thing I am trying to do. I have a column of cells that have multiple values, some with text and some with no values at all. I want to be able to display in A1 the most commonly occurring text in cells C1:C15, and be able to display in B1 the number of times that A1 occurs in the same range. Below are the formulas that I am using. There are two problems that I am running into: First, the formula returns a #NA error if any of the cells in the range are left blank. Second, the formula counts the spaces or zeros, so if there are more blanks than the word “amber” then A1 returns “ ” and B1 returns the corresponding number.

A1
=INDEX(C1:C15,(MODE(MATCH(C1:C15,C1:C15,0))))

B1
=COUNTIF(C1:C16,A1)

2. Second thing I am trying to do. In A2 I want to display the second most commonly occurring text in the range, with it’s corresponding count in cell B2, and the third most in A3 and B3, etc

Illustration:

C1 Amber
C2 Red
C3
C4
C5
C6 Red

Desired result:

A1 "Red" B1 "2"
A2 "Amber" B2 "1"

Results with forumla as posted

A1 " " B1 "3"

View 10 Replies View Related

Count Number Of Unique Values After 1st Part Of Cell Matches?

Aug 8, 2014

Have numerous values in Col A. Col E extracts a list of unique values from that column.

In Col C, the Col A value has had characters added to it.

Need a formula to count the number of unique values from Col C which contain the same prefix from Col A, and place the result in Col F.

A sample workdook is attached with the desired result shown and highlighted in yellow.

View 9 Replies View Related

Count Number Of Rows In Specific Column Up To Empty Cell

Feb 13, 2013

I want to count the number of rows in a specific column up to an empty cell and assign this value to a cell. I don't want to count the total number of rows but instead I want the number of the first group of rows.

For example, column A may have cells ranging from row 2 to 10 and then from row 12 to 20, so I only want to count the first group.

The below code counts the total which is not what i need.

Code:
Sub test()
Dim Mycount As Single
Mycount = Application.Count(Range("A:A"))
Cells(1, 4) = Mycount
End Sub

View 2 Replies View Related

Count Total Number Of Times That A Cell Or Font Is A Certain Color

Sep 19, 2008

Is there a way that I can add up the ?

When I try to use IF formulas it is asking for text but I don't want it to look at text and just the color.

View 9 Replies View Related







Copyrights 2005-15 www.BigResource.com, All rights reserved