Count How Many Times The Value Appear

Sep 21, 2009

Im using a DDE to auto update my sheet, every time the word BUY appears on the cell T3 I need update a new table with the following data

=name | =number of times the word appeared

Where name is a reference to the value on the cell C3

View 14 Replies


ADVERTISEMENT

Count If- Formula That Will Count The Number Of Times

Jan 16, 2006

in writing a formula that will count the number of times
the store is listed (Column B) when it matches with closed (Column C).

On the table listed below I will return the data using a match.

From this table
A B C
1/8/2006 9:45Store 1Closed
1/8/2006 9:57Store 2Closed
1/8/2006 10:05Store 3Closed
1/8/2006 10:09Store 4Closed
1/8/2006 10:15Store 5Closed
1/8/2006 10:24Store 1Closed
1/8/2006 10:36Store 2In Progress
1/8/2006 10:41Store 3In Progress
1/8/2006 10:50Store 4Closed
1/8/2006 10:58Store 5Closed
1/8/2006 10:59Store 1Closed
1/8/2006 11:15Store 2Closed
1/8/2006 11:22Store 3In Progress
1/8/2006 11:24Store 4In Progress
1/8/2006 11:33Store 5Closed
1/8/2006 11:51Store 1Closed
1/8/2006 11:56Store 2Closed
1/8/2006 11:57Store 3Closed
1/8/2006 12:03Store 4Closed
1/8/2006 12:16Store 5Not Started
1/8/2006 12:23Store 1Closed
1/8/2006 12:28Store 2Closed
1/8/2006 12:57Store 3Closed

To this table

A B C
1/8/2006 9:45Store 15
1/8/2006 9:57Store 24
1/8/2006 10:05Store 33
1/8/2006 10:09Store 43

View 11 Replies View Related

Count Times Between 2 Specified Times

Sep 15, 2006

I thought I found a formula that would work, but it's not working. Each month I have to count the number of service tickets that have arrived between certain time ranges. They want to gauge during what times we seem to get the biggest batch of service requests.

6 am to 10 am
10 am to 5 pm
5 pm to 6 pm
6 pm to 6 am

The format of the cells are:

1:21:19 AM
1:28:08 AM
1:35:48 AM
1:49:19 AM
2:17:02 AM
7:14:38 AM
7:29:12 AM
8:08:28 AM
8:51:48 AM
8:54:19 AM

The formula I tried for 10 am to 5 pm: =COUNTIF(B2:B677,">="&TIME(10,0,0))-COUNTIF(B2:B677,">"&TIME(17,0,0))

It gives a result of 676, and I know from manually counting that there is only 327 cells that have a time between 10 am and 5 pm.

View 3 Replies View Related

Count How Many Times Names Appear

Oct 28, 2008

Every day I pull a report showing a list of agents that committed an infraction. I want to be able to count how many times each agent committed an infraction. How do I do that? I tried Frequency and it did not work, or am I missing something?

View 5 Replies View Related

Count Times Between Hours

Apr 27, 2007

I am working on a spreadsheet where I want to count the number of calls to our service desk between specific hours (ie. 6:00 a.m. - 7:00 a.m.) up through 8:00 p.m. I have looked at all the forums and tried all the formulas that seemed to be what I was looking for and it isn't working! I am adding the information to a summary spreadsheet from which I am gathering the information from other sheets in the workbook. This will be an ongoing spreadsheet done weekly for every month.

Examples: I need to know how many calls from these times on a summary sheet.

6:23
6:28
6:59
7:09
7:35
7:38
8:00
8:26
8:34
8:42
8:43
9:02
9:04
9:23
9:27
9:31
10:06
10:23
10:37
10:51
11:05
11:09
11:19

View 9 Replies View Related

Count # Times A Cell Changes

Aug 5, 2007

I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.

View 9 Replies View Related

Count The Number Of Times ...

Apr 24, 2008

Attempting to do a countif as follows

Count the number of times that F2:F65536=Q1 where E2:E65536 also = N2.

So for a given row, the cell in col F needs to equal Q1 and the cell in col E needs to equal N2 for it to count.

View 9 Replies View Related

Voting Results - Count Times Value

Apr 22, 2014

I have a situation in which i have a set of voters ranking performance of others. I need to create a dynamic situation in which as the voter changes the vote it will keep the information updated.

I have attached the data and the stripped down start of what i had. Formulas i can think of to get this done are not working, any combo of functions to get this to work out.

The score represents the total rank given by that voter. I totaled up what participant 5 should be given in terms of points. My design thought was to create a dynamic function that updates the summary page and then use the summary (participant) page to run a pivot.

Voting Results.xlsx‎

View 1 Replies View Related

Match And Count Individually All The Times

Jan 26, 2009

My table has one column C with 3 possible values. Column D has either TRUE or FALSE. I am trying to count individually all the times when B = True (F4), T=TRUE (F5) and B/T =TRUE (F6) excluding the blank cells.

But the final goal is to display the total figure required to be answered, but as each question is answered yes or no subtract 1 from the displayed figure. My sumproduct adds up the "B" but does not match with a "TRUE"

View 4 Replies View Related

Count How Many Times A Letter Occurs

Mar 15, 2009

I want to count the occurrence of certain letters in a range of cells. In my attachment I need the sum of how many times the letters "C,M,Y,K" occur in the range A2:D2.

View 2 Replies View Related

Count How Many Times Appears Number 2 In A Box

Nov 26, 2006

I have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2",""))
in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.

View 14 Replies View Related

Count How Many Times A Particular Website Was Repeated

Oct 23, 2008

I'm just using the "=COUNTIF" function to count how many times a particular website was repeated, but I have no idea if such website is among the top five that appear the most throughout. Finding that manually, given the ridiculous size of the data provided, would take days!

View 4 Replies View Related

Data Count How Many Times Each Value Occurs

Feb 26, 2010

I have a list of data, integer values ranging from 0 to 36. Imagine a Roulette wheel. The list is long, with over one hundred data points. I would like to view the first 14 data points, and count how many times each value occurs. How many 0's? How many 1's? How many 2's?...How many 36's?

Obviously, many values will have 0 occurrences. Most will have 1 occurrence, some 2, and maybe one or two will have 3 occurrences. I doubt we will see a value with 4 or more occurrences, but it is possible. With this accomplished, I will then note the results. So, that accomplishes the first 14 data points, call them 1-14.

Then, I want to move down the list 1 data point, and repeat the process. So, here I am looking at data points 2-15. Basically, it's the same set of data, with the first point missing, and a new point added on. I will then note the results. I want to continue doing this until the last 14 are viewed.

View 3 Replies View Related

Count Number Of Times A Certain Cell Changes?

Aug 5, 2007

I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.

View 9 Replies View Related

Count How Many Times Name Appear In A Column For Every Single Day

Jul 22, 2013

I have a column A with names (let's say that we have four names: A, B, C, D) and a column B with dates.

I need a formula to count how many times appears a name in a column, for every single day (because in a single day a name may appear more than once).

Is this possible with a formula or I need to think at VB?

View 9 Replies View Related

Get Value Occuring Maximum Times And Its Count

Aug 14, 2009

I have a column with over 60,000 rows of data. I need to find out which value in the table occurs the maximum number of times, and its count.

The traditional methods of COUNTIF or INDEX/MATCH using MODE dont seem to work and excel crashes after a few mins.

Is there any other way to do the same (other than splitting the file into several smaller files)?

View 9 Replies View Related

Count Number Of Times Names Appear In Column?

Jan 6, 2014

I have a list of names all in one column, separated by row...

Example...

John Doe
John Doe
Jane Doe
Jane Doe
Jane Doe
James Jones
James Jones

I want to count how many times each name appears. Like this:

John Doe | 2
Jane Doe | 3
James Jones | 2

This is a very large list of names and I prefer not to have to type each single name into a formula because there are hundreds of separate names.

View 4 Replies View Related

Count How Many Times The Value Adhesive / Tapes Appears In Col CV

Jun 10, 2014

I an trying to count how many times the value "Adhesive/tapes" appears in col CV but only where there is a corresponding value of "Prat","Onsite" in col CV......

I thought that this would work but is returning a #Value error....

=COUNTIFS($AZ$1:$AZ$10380,"Adhesive/tapes",$CV$2:$CV$10380,{"Prat","Onsite"})

View 5 Replies View Related

Count The Number Of Times Each Entered Name Appears

Feb 4, 2010

I am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter

View 2 Replies View Related

Count The Number Of Times A Particular Staff Name Appears

Oct 22, 2007

I have a sheet set up to record free pour tests for my bar team.

Column A has the date.
Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names
Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.

What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.

I can easily count the names, but how do I count if they have pass or failed?

View 12 Replies View Related

Count How Many Times Specific Name Appears In Column

Feb 28, 2012

I have a two ranges of columns containing names. I need to count how many times a specific name appears in ColumnN - Easy enough =COUNTIF(N$2:N$1047,Q3) ...Q3 being the name I am looking for.

Now comes the part I am stuck on. I need to count how many times a name appears in ColumnK but only if there is no name in ColumnN.

I tried =IF(COUNTIF(N3:N1047,""),COUNTIF(K2:K1047,T3),)

View 2 Replies View Related

How To Count Number Of Times A Phrase Is Repeated In A Row

Jun 24, 2012

How I can count the number of times each unique phrase in row "A" is repeated?

For example if my data set was

Blue
Green
Black
Green
Red
Red
Red
Red Hat

how can I get excel to count the number of times and return data like

Blue 1
Green 2
Black 1
Green 2
Red 3
Red 3
Red 3
Red Hat 1

View 3 Replies View Related

Count How Many Times A Particular Text Appears In Column?

Nov 25, 2013

I want to count how many times a particular text appears in Column A depending on the number times another text appears in Column B.

Say for example if I have in Column A {A, B, C, D}nd column B I have {AA,BB,CC) and if I want to check how many times column A has "A" value when the column B has "CC" value, then how should I proceed with this ?

View 3 Replies View Related

Count How Many Times Got Same Character In Text From Several Cells

Jan 30, 2014

I need to count how many times I've got, for instance, "a" in several cells where I typed some text...

I would need a formula where I can indicate the letter I want and the range of cells where to look at, and having as result how many occurances there are...

If you are very good instead of a single letter, maybe a sequence of letters... but this is an extra!

View 5 Replies View Related

Count The Number Of Times :: Regional Inventory

Mar 3, 2009

I'm trying to filter data into a cell that meets certain criteria...

I would like to count the number of times a sku is found in each region in each month... daily inventory counts are recorded.. the date is recorded as MM/DD/YYYY...

is sumproduct my solution? I'm getting errors, specifically #NAME?

=sumproduct((sheet1!L:L=SKU)*(sheet1!M:M=Region)*(sheet1!C:C>=1/1/2009)+(sheet1!C:C

View 9 Replies View Related

Count Frequency Of Times Variable Strings In A Range

Nov 17, 2012

I have a list of names in C1 down that I want to count. There could be hundreds of names in C1 and I don't want to sumif all of them. There must be a simpler solution

View 1 Replies View Related

Count Unique Names Only Not The Number Of Times It Appears?

Apr 4, 2013

I've got a set of data that I update once a month and the number of team members per team changes all the time. I'm trying to write a formula that basically says, if the date matches AND the manager name matches, count the number of team members.

In the attached sample if A2 and B4 are found in the data set, count the number of SalesReps they have. So I'm looking at Sarah for February 2013, she has two sales reps that sold something, but Katherine appears twice, so I'm not looking for a result of 3, the correct answer is 2. How do I write the formula?

A2 will look to the data range of A14:A23 and SarahK will look to I14:I23, but I want to count H14:23.

View 9 Replies View Related

Count Number Of Times One Value Is Higher Than Another IF Criteria Is True?

Dec 17, 2013

I have two columns with values. Then I have a third column with one letter A or B.

I'm not used to excel, but I've tried my way with COUNTIFS and I'm pretty sure it's the way to go, but I'm lost in the syntax.

I want to count the number of times the values in the first column is larger than the values in the second column, if the letter is A. And then flip the ">" sign and count that and hopefully the first number is higher.

View 4 Replies View Related

Count Number Of Times Letter A Appears In Cell?

May 31, 2014

i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?

View 8 Replies View Related

Formula To Check Two Times And Count The Colum Figures

Nov 28, 2006

I need a formula to check two times and count the colum figures.

example only:

countif(=>4:30:00 PM <=5:30:00 PM)*(11/12/06)

So, I need to count all cells with time between 4:30 and 5:30 with the date of 11/12/06.

View 14 Replies View Related







Copyrights 2005-15 www.BigResource.com, All rights reserved