Count # Times A Cell Changes
Aug 5, 2007I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.
View 9 Replies
ADVERTISEMENT
Count Number Of Times A Certain Cell Changes?
Aug 5, 2007I want to count every time a certain cell changes. For example, if C2 is currently set at August 5, 2007 and I change it to August 12, 2007, then add 1 to cell B2.
View 9 Replies View RelatedCount Number Of Times Letter A Appears In Cell?
May 31, 2014i have this in my 1 cell: ttgtcctacttacaacactgtgcttagtaatggttattgcgactttatccttgttctgaa i want to count how many "a" in this cell . which formula i can use to solve this problem ?
View 8 Replies View RelatedCount Total Number Of Times That A Cell Or Font Is A Certain Color
Sep 19, 2008Is there a way that I can add up the ?
When I try to use IF formulas it is asking for text but I don't want it to look at text and just the color.
Count If- Formula That Will Count The Number Of Times
Jan 16, 2006in writing a formula that will count the number of times
the store is listed (Column B) when it matches with closed (Column C).
On the table listed below I will return the data using a match.
From this table
A B C
1/8/2006 9:45Store 1Closed
1/8/2006 9:57Store 2Closed
1/8/2006 10:05Store 3Closed
1/8/2006 10:09Store 4Closed
1/8/2006 10:15Store 5Closed
1/8/2006 10:24Store 1Closed
1/8/2006 10:36Store 2In Progress
1/8/2006 10:41Store 3In Progress
1/8/2006 10:50Store 4Closed
1/8/2006 10:58Store 5Closed
1/8/2006 10:59Store 1Closed
1/8/2006 11:15Store 2Closed
1/8/2006 11:22Store 3In Progress
1/8/2006 11:24Store 4In Progress
1/8/2006 11:33Store 5Closed
1/8/2006 11:51Store 1Closed
1/8/2006 11:56Store 2Closed
1/8/2006 11:57Store 3Closed
1/8/2006 12:03Store 4Closed
1/8/2006 12:16Store 5Not Started
1/8/2006 12:23Store 1Closed
1/8/2006 12:28Store 2Closed
1/8/2006 12:57Store 3Closed
To this table
A B C
1/8/2006 9:45Store 15
1/8/2006 9:57Store 24
1/8/2006 10:05Store 33
1/8/2006 10:09Store 43
Excel 2003 :: Count How Many Times A Word Is In A Range / Word Can Be In Cell More Than Once
Feb 16, 2012I need to count how many times the word Test is in the range B4:H9 with
Range N2 = Test the formula below works if Test is only in the cell once.
=COUNTIF($B$4:$H$9,"*" & N2 & "*")
But I have data in cells like below, this is all in one cell, so how would I have it count all the times test is in the range when some cells have test 2 or more times in a single cell?
5
Test
8am-2pm
Test
5pm-10pm
Count Times Between 2 Specified Times
Sep 15, 2006I thought I found a formula that would work, but it's not working. Each month I have to count the number of service tickets that have arrived between certain time ranges. They want to gauge during what times we seem to get the biggest batch of service requests.
6 am to 10 am
10 am to 5 pm
5 pm to 6 pm
6 pm to 6 am
The format of the cells are:
1:21:19 AM
1:28:08 AM
1:35:48 AM
1:49:19 AM
2:17:02 AM
7:14:38 AM
7:29:12 AM
8:08:28 AM
8:51:48 AM
8:54:19 AM
The formula I tried for 10 am to 5 pm: =COUNTIF(B2:B677,">="&TIME(10,0,0))-COUNTIF(B2:B677,">"&TIME(17,0,0))
It gives a result of 676, and I know from manually counting that there is only 327 cells that have a time between 10 am and 5 pm.
Count Hours Between 2 Times Based On Hours In Another Cell
Jun 11, 2008A1 is 10 (10 hrs worked) , A2 is 10:30am (in time), A3 is 9:00pm (out time), A4 needs to be the total hours and minutes between A2 and A3 based on the hours listed in A-1. What i need is a formula that will calculate the hours and minutes between the 2 times based on hours entered in A1 but that will also compensate for a manadatory 30 minute lunch that needs to be deducted from the total hours if hrs listed in A1 are more than 6.
example: worked 10HRS, 10:30am to 9:00pm, Total hrs is 10hrs 30min, which should be just 10 since the lunch is a none work time and must be subtracted.
If a person worked more than 6hrs, they must take a lunch. if they worked less, than 6 then they don't have to. I need a calcuation to recognize the greater than, less than factor into the equasion also.
Count How Many Times The Value Appear
Sep 21, 2009Im using a DDE to auto update my sheet, every time the word BUY appears on the cell T3 I need update a new table with the following data
=name | =number of times the word appeared
Where name is a reference to the value on the cell C3
Count How Many Times Names Appear
Oct 28, 2008Every day I pull a report showing a list of agents that committed an infraction. I want to be able to count how many times each agent committed an infraction. How do I do that? I tried Frequency and it did not work, or am I missing something?
View 5 Replies View RelatedCount Times Between Hours
Apr 27, 2007I am working on a spreadsheet where I want to count the number of calls to our service desk between specific hours (ie. 6:00 a.m. - 7:00 a.m.) up through 8:00 p.m. I have looked at all the forums and tried all the formulas that seemed to be what I was looking for and it isn't working! I am adding the information to a summary spreadsheet from which I am gathering the information from other sheets in the workbook. This will be an ongoing spreadsheet done weekly for every month.
Examples: I need to know how many calls from these times on a summary sheet.
6:23
6:28
6:59
7:09
7:35
7:38
8:00
8:26
8:34
8:42
8:43
9:02
9:04
9:23
9:27
9:31
10:06
10:23
10:37
10:51
11:05
11:09
11:19
Count The Number Of Times ...
Apr 24, 2008Attempting to do a countif as follows
Count the number of times that F2:F65536=Q1 where E2:E65536 also = N2.
So for a given row, the cell in col F needs to equal Q1 and the cell in col E needs to equal N2 for it to count.
Voting Results - Count Times Value
Apr 22, 2014I have a situation in which i have a set of voters ranking performance of others. I need to create a dynamic situation in which as the voter changes the vote it will keep the information updated.
I have attached the data and the stripped down start of what i had. Formulas i can think of to get this done are not working, any combo of functions to get this to work out.
The score represents the total rank given by that voter. I totaled up what participant 5 should be given in terms of points. My design thought was to create a dynamic function that updates the summary page and then use the summary (participant) page to run a pivot.
Voting Results.xlsx
Match And Count Individually All The Times
Jan 26, 2009My table has one column C with 3 possible values. Column D has either TRUE or FALSE. I am trying to count individually all the times when B = True (F4), T=TRUE (F5) and B/T =TRUE (F6) excluding the blank cells.
But the final goal is to display the total figure required to be answered, but as each question is answered yes or no subtract 1 from the displayed figure. My sumproduct adds up the "B" but does not match with a "TRUE"
Count How Many Times A Letter Occurs
Mar 15, 2009I want to count the occurrence of certain letters in a range of cells. In my attachment I need the sum of how many times the letters "C,M,Y,K" occur in the range A2:D2.
View 2 Replies View RelatedCount How Many Times Appears Number 2 In A Box
Nov 26, 2006I have a problem with LAN function. I have following formula to count how many times appears number 2 in a box: LEN(I5)-LEN(SUBSTITUTE(I5,"2",""))
in I5 I have 1,2,3,12,34,22,21 . Outcome is 5 which is not what I need. What I wanted to do is to get output of how many times appears number 2, not how many times appears expression 2 (it counts also 22, 21, 12, 2) . The output that I need should be 1 since number 2 appears just once in the box.
Count How Many Times A Particular Website Was Repeated
Oct 23, 2008I'm just using the "=COUNTIF" function to count how many times a particular website was repeated, but I have no idea if such website is among the top five that appear the most throughout. Finding that manually, given the ridiculous size of the data provided, would take days!
View 4 Replies View RelatedData Count How Many Times Each Value Occurs
Feb 26, 2010I have a list of data, integer values ranging from 0 to 36. Imagine a Roulette wheel. The list is long, with over one hundred data points. I would like to view the first 14 data points, and count how many times each value occurs. How many 0's? How many 1's? How many 2's?...How many 36's?
Obviously, many values will have 0 occurrences. Most will have 1 occurrence, some 2, and maybe one or two will have 3 occurrences. I doubt we will see a value with 4 or more occurrences, but it is possible. With this accomplished, I will then note the results. So, that accomplishes the first 14 data points, call them 1-14.
Then, I want to move down the list 1 data point, and repeat the process. So, here I am looking at data points 2-15. Basically, it's the same set of data, with the first point missing, and a new point added on. I will then note the results. I want to continue doing this until the last 14 are viewed.
Count How Many Times Name Appear In A Column For Every Single Day
Jul 22, 2013I have a column A with names (let's say that we have four names: A, B, C, D) and a column B with dates.
I need a formula to count how many times appears a name in a column, for every single day (because in a single day a name may appear more than once).
Is this possible with a formula or I need to think at VB?
Get Value Occuring Maximum Times And Its Count
Aug 14, 2009I have a column with over 60,000 rows of data. I need to find out which value in the table occurs the maximum number of times, and its count.
The traditional methods of COUNTIF or INDEX/MATCH using MODE dont seem to work and excel crashes after a few mins.
Is there any other way to do the same (other than splitting the file into several smaller files)?
Count Number Of Times Names Appear In Column?
Jan 6, 2014I have a list of names all in one column, separated by row...
Example...
John Doe
John Doe
Jane Doe
Jane Doe
Jane Doe
James Jones
James Jones
I want to count how many times each name appears. Like this:
John Doe | 2
Jane Doe | 3
James Jones | 2
This is a very large list of names and I prefer not to have to type each single name into a formula because there are hundreds of separate names.
Count How Many Times The Value Adhesive / Tapes Appears In Col CV
Jun 10, 2014I an trying to count how many times the value "Adhesive/tapes" appears in col CV but only where there is a corresponding value of "Prat","Onsite" in col CV......
I thought that this would work but is returning a #Value error....
=COUNTIFS($AZ$1:$AZ$10380,"Adhesive/tapes",$CV$2:$CV$10380,{"Prat","Onsite"})
Count The Number Of Times Each Entered Name Appears
Feb 4, 2010I am trying to simply count the number of times each entered name appears on my list IE if John Smith appears 3 times in one sheet, in a column after his name would simply be the number 3. I tried this doing =COUNTIF(A8,A:A) Where A8 is his name and column A is all names. I keep a return value of 0 every time!!!!! I even tried =COUNTIF(A7,A12) where they were both the same names. And yes,I did do Ctrl + Shift - enter
View 2 Replies View RelatedCount The Number Of Times A Particular Staff Name Appears
Oct 22, 2007I have a sheet set up to record free pour tests for my bar team.
Column A has the date.
Alternating columns from B (B..D..F.. etc) hold a drop down with the staff names
Alternating columns from C (C..E..G.. etc) hold a drop down with either pass or fail as the result.
What I need to do is count the number of times a particular staff name appears, but more importantly how many times they pass or fail.
I can easily count the names, but how do I count if they have pass or failed?
Count How Many Times Specific Name Appears In Column
Feb 28, 2012I have a two ranges of columns containing names. I need to count how many times a specific name appears in ColumnN - Easy enough =COUNTIF(N$2:N$1047,Q3) ...Q3 being the name I am looking for.
Now comes the part I am stuck on. I need to count how many times a name appears in ColumnK but only if there is no name in ColumnN.
I tried =IF(COUNTIF(N3:N1047,""),COUNTIF(K2:K1047,T3),)
How To Count Number Of Times A Phrase Is Repeated In A Row
Jun 24, 2012How I can count the number of times each unique phrase in row "A" is repeated?
For example if my data set was
Blue
Green
Black
Green
Red
Red
Red
Red Hat
how can I get excel to count the number of times and return data like
Blue 1
Green 2
Black 1
Green 2
Red 3
Red 3
Red 3
Red Hat 1
Count How Many Times A Particular Text Appears In Column?
Nov 25, 2013I want to count how many times a particular text appears in Column A depending on the number times another text appears in Column B.
Say for example if I have in Column A {A, B, C, D}nd column B I have {AA,BB,CC) and if I want to check how many times column A has "A" value when the column B has "CC" value, then how should I proceed with this ?
Count How Many Times Got Same Character In Text From Several Cells
Jan 30, 2014I need to count how many times I've got, for instance, "a" in several cells where I typed some text...
I would need a formula where I can indicate the letter I want and the range of cells where to look at, and having as result how many occurances there are...
If you are very good instead of a single letter, maybe a sequence of letters... but this is an extra!
Count The Number Of Times :: Regional Inventory
Mar 3, 2009I'm trying to filter data into a cell that meets certain criteria...
I would like to count the number of times a sku is found in each region in each month... daily inventory counts are recorded.. the date is recorded as MM/DD/YYYY...
is sumproduct my solution? I'm getting errors, specifically #NAME?
=sumproduct((sheet1!L:L=SKU)*(sheet1!M:M=Region)*(sheet1!C:C>=1/1/2009)+(sheet1!C:C
Count Frequency Of Times Variable Strings In A Range
Nov 17, 2012I have a list of names in C1 down that I want to count. There could be hundreds of names in C1 and I don't want to sumif all of them. There must be a simpler solution
View 1 Replies View Related