Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
I'm needing to generate a unique random value for a database with 3546 cases. The unique random values cannot be duplicates of each other. I tried the =RANDLOTTO function that I learned of in an old post on this board, but that results in "#NAME?" appearing in the first cell. I tried to install the Add-Ins (both the Analysis ToolPak and the Analysis ToolPak - VBA, but nothing seems to happen. Is there another way to generate these numbers?
View 9 Replies View RelatedI have 1200 doctor/patient records to input into an excel spreadsheet for import to an online EHR database. I can set up all the normal formulas and formatting but for the life of me not figure out how to create a custom formula to take the first letter of the patient first name and last name and add 6 figures to create a unique patient identifier.
ie. James + Smith+ random 6 figures = JS245318.
In my spreadsheet the first name is under Column 1, Last name Column 3 and the unique number generated in column 4.
How do I create a 6 digit unique random number for use as an ID in column A. Once created the rows with preexisting 6 digit unique random ID numbers must not change every time new rows are added.
View 9 Replies View RelatedHow to do a sheet with random letters... I got this macro but is not working
Sub RandomLetters()
Dim RandomRange As Range, cell As Range
Set RandomRange = Range("C10:AG15")
For Each cell In RandomRange
cell.Formula = "=RANDL(A,M)"
Next
RandomRange.Value = RandomRange.Value
End Sub
The range is set. but the cell.formula is not... i want to set the macro to random the letters (N ,M, T, E, DS) without their being repeated at the same column is that possible???
I have what seems to be a pretty complicated situation involving random numbers and letters. I need to generate random sets of this combination of 2 letters follows by 6 numbers (ex. AB123456). I need the final product to be randomly generated and non-repeated.
I have played with various methods of producing random numbers and random letters both repeated and non-repeated. The closest I can get would be a cell of randomly generated letters adjacent to a cell of randomly generated numbers which so far has been useless.
VBA or excel functions are both okay.
What I'm trying to do is as follows:
Sheet 1
A1 through A6 has STR, DEX, CON, INT, WIS and CHA. B1 through B6 is waiting for results from sheet 2.
Sheet 2
A1 is data validation of d4, d6, d8, d10, d12, d20 and d100. A2 through A7 are currently Rand formulae triggered by A1 with B1 adding number of dice (minimum 1) and B2 a modifier value add to the rolled result. D2 through D7 are data validation modifiers of -10 to +10 (0 included). E2 through E7 is the result of A2+C2. The Rand works fine, but every time data is changed Rand recalculates. I'm hoping for a macro executed by a button to generate six random numbers based on the chosen die value of A1 ranging from 1-4 to 1-100. The die roll can never be below 1 and no higher than the chosen die. I then want to transfer the result from E? To sheet 1 B1 to B6 matching its appropriate atribute. I named them Char01_STR, etc on sheet 1 A1 to A6.
I have an excel database that contains a code to identify specific people.
NAME ADDRESS PHONE CODE
Jones 3 Quay St, PN 063586954 JU79N4
White 24 Dyk St, PN 063547786 9GVJ64
Smith 9 Random St, PN 063512698 4LN867
Butt 89 Yeah Pl, PN 063569986 D920HK
Handle 69 James Ct, PN 06 3549687 ZK26S84
If I wanted to filter the list so I only had codes that had Z, N, H in it. How do I do that??
I've got this problem: I need to separate around 40 alphanumerical entry in Column'A' to Columns'B','C','D','E'..
View 6 Replies View RelatedI have words in cell range (i.e. A1:A1000) and I want them to became upper letters.
Excel forum to EXCEL FORUM
I have the Range B:F for "Values MJ" and columns G:K with "Values RT". In column A there is a letter for each row but some letters could appear more than once and I want to have only unique letters in column A and merged the Range B:F for "Values MJ" and columns G:K with "Values RT" in the same row for those repeated letters.
Original data:
A
B
C
D
E
F
G
H
I
J
[Code]...
If a letter only have values in range B:F print "Missing" in range G:K for the same row. If a letter only have values in range G:K print "Missing" in range B:F for the same row.
I'd like to delete the row of the letter if the repeated letter has values in B:F, since letters for ranges B:F always appear after the letters that have values in range G:K and since I'd like the output in same sheet.
Output desired:
A
B
C
D
E
F
[Code]...
I want to generate numbers (1 to 15) in cells A1 through O1, but the
number in each cells should be unique compare to the other cells, how
can I do it? If I use =randbetween(1,15), I can not get unique number
in each cell, some numbers are duplicated.
I have data table
A3:D103
Column A are unique serial numbers
Column B, C, D contains test values.
F1= 50 (No Of unique random samples to be pulled - No Duplicates)
The out put range for sample data starts from F3:I3
I have 12 Cells, years 1 to 12. I want to create a random number for each cell, which then depending on what the number is, either 1-75 being 8,000,000 or 76-100 being 10,500,000, place it in the cell and be able copy it down. What i have done already you can see on the attached workbook, or the table i used:
I used this table to generate the random number to give either 8m or 10.5m, except i put the VLOOKUP in the year 1 cell, added some dollars signs and copied down but that only makes them all the same, so i want a way to make each year have its own random number preferably without making 10 tables.
I need a macros to fill 2000 rows with unique random numbers from 1 to 19 in B2:T2001 area. Every row like this
14 11 12 7 18 13 19 5 6 16 9 4 8 15 1 3 10 2 17
Actually it's about random positions in rows for numbers from 1 to 19.
I need to set up a formula to choose 2 job titles from a single column. There can be 2 to n job titles (non-repeating) and I want to find the title at random. I have no problem finding the first job title using index and randbetween, but I want the second title to meet the same criteria, just not equal to the first job title.
View 3 Replies View RelatedI have a formula-generated defined list of names. I need to select them in random order without duplication and without choosing any blanks in the list.
View 6 Replies View RelatedIn an earlier life I was tasked with finding a "random" method of selecting two numbers from a "1 to 20" range so that the generated numbers can be applied to an set of people who will be partnered in a golf game draw.
It is only one draw per year so I don't care if the players have previously played together in past years.
easily be modified by a "passable knowledge level" person to be able to select a mystery "9" out of 18 holes that count for scores that particular round.
(btw: this is an issue only for the 20 guys who go away once a year to play golf, the world will not collapse if I have to draw numbers out of a hat, just looking for a slightly more elegant solution and I already have a few scoring macros so my first guess (but not only possibility) is VBA)
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
How do I make a row of 5 random numbers in A2:A6 that are not the same as each other. It's basically for a Bingo card. I have a formula that can calculate the random numbers =INT(RAND()*15)+1 under the B's for example, but I can't seem to figure out how to make it so they are not the same.
