I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
I am sure this should be REALLY simple, but i just can't find the answer i'm looking for. I have a sheet which changes daily in quantity of information. I want some simple code which counts up the number of populated cells in column A and returns the answer to a cell in another worksheet - or just automatically use it to print that number of pages.
I think i should be able to do the printing side, but, currently have no idea how to count up the number of populated cells in the row. If someones feeling very generous though, giving me the code for printing that number of pages too would save me some work (the worksheet which needs printing is different to the worksheet which needs the number of cells adding up.)
I am trying to create a graph that is conditional on two different columns. The first column is a date column, the second column has various categories. I want to show how many times each category appears per month. This database is continually added to so I wanted the formula to reflect the entire column range.
For example, let say I have 5 categories (Grapes, Apples, Peach, Pear, Banana). Column A would show a date (in a M/D/Y format) and Column B would list the fruit type. I want to show how many Grapes were input in January, February, March, etc. and then move on to show how many apples in each month, and so on.
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
I am basically looking for a method to fill in information through VBA in excel into a 2-D grid. Ideally I would like this to work but it does not.
View 14 Replies View Relatedthis topic is semi-related to to the link below..its not need to look at it..its just for reference.
basically in this topic i just need help condensing the formula in cell "C18"
it just counts the capital letters in cell "B18"
http://www.mrexcel.com/forum/search....archid=1894488
Sheet7
ABC18Micheal Johnson JonesM. J. J. 319United States of AmericaU. S. A. 320Laugh Out LoudL. O. L. 3
Spreadsheet FormulasCellFormulaB18=init(A18)C18=LEN(B18)-LEN(SUBSTITUTE(B18,"A",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"B",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"C",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"D",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"E",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"F",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"G",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"H",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"I",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"J",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"K",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"L",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"M",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"N",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"O",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"P",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Q",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"R",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"S",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"T",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"U",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"V",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"W",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"X",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Y",""))+LEN(B18)-LEN(SUBSTITUTE(B18,"Z",""))
Excel tables to the web >> Excel Jeanie HTML 4
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies View RelatedIf I have two columns of data, and I want to count the numbers of times a certain letter appears in column A and another certain value appears in column B, I use the following formula:
=sumproduct((AA="yes")*(BB:="X"))
What formula would I use to count the number of times "yes" appears in column A, AND EITHER "X", "Y", or "Z" appear in column B?
Would this still be a SUMPRODUCT formula, or would a cOUNTIF formula be used?
How about counting the times certain letters appear in THREE columns?
I have managed to get a nice array formula to look up count all the Rs As & Gs in some cells and return whichever there are most of (the cells are linked to/fed from another workbook with cells that have either an R, A or G in - nothing else)
And mainly this is working but on one set of cells it returns nothing as there are 2 As and 2 Gs - what is really annoying is that on a set of cells on a another section of the tab there are 5 A's and 5 G's and that returns an A.
I have number in cell (A1) = 100. when I enter number in any cell of column(B) for example (B1)=10. then in cell (C1) the result of (A1) - (B1) = (90) and if I add in cell (B2)=10 then in cell (C1) the result of (A1) - (B1+B2) = 80 .accumulatively in cell (C1). and any number in column (B), the result will be (A1) minus any number in column(B) accumulated in (C1)
second question
I have number in cell (A1) = 100. when I enter number at cell (B1) = 10 then the result would be in the adjacent cell (C1) = (A1) - ( B1) = 90 and If I enter a new number in cell (B2) = 10 then the result would be in the adjacent cell (C2) = (A1) - (B1+B2) = 80 and If I enter a new number in cell (B3) = 10 then the result would be in the adjacent cell (C3) = (A1) - (B1+B2+B3) = 70 and so on. I want the result to be add automatically to adjacent cell in column (C)
I have a spreadsheet with 3 coloumns. In A I enter Address, B Date, C Ward/District Area (this is a data validation list). At present I use; = SUMPRODUCT((HFRA!B4:B2000>=Summary!B1)*(HFRA!B4:B2000<=Summary!B2)). Summary B1 and B2 are dates to search between e.g 1/01/07 and 31/01/07. The above formula only counts the date enteries between B1 and B2.
I would like to change this so that it still checks that the date still falls between B1 and B2 but is adds together the numbers entered in coloum A. So coloumn A would become number of completed actions not an address.
I have a requirement where I have to count number of "-" character in particular row
I am using a excel database for promotion records of my team....The data base works as follows. I am using countif function to calculate number of associates in specific grade for specific month. One associate is getting promoted to next level, I will add one more row with the same employee name with change in designation and diff start and end date. I want to generate report for monthly promotions, The report should depict number of promotions in each month. ie in Jul there is one promotion from trainee to Engg for EMP1. There are hundreds of employees, eligible for promotion in each month.
A B C D E F G H I J K L
Emp Name Desig From Date To Date Apr-13 May-13 Jun-13 Jul-13 Aug-13 Spt 13 Oct-13 Nov-13
EMP 1 trainee 4-1-13 6-30-13 trainee trainee trainee - - - - -
EMP 1 Engg 7-1-13 11-30-13 - - - Engg Engg Engg Engg Engg
I'm trying to write a macro that will find a value beginning "ber" and paste it across to a different column. I have had a go at it but I keep getting the offset flagged up.
It needs to move 15 columns across and 7 rows down if that is of any importance.
I have an excel database that contains a code to identify specific people.
NAME ADDRESS PHONE CODE
Jones 3 Quay St, PN 063586954 JU79N4
White 24 Dyk St, PN 063547786 9GVJ64
Smith 9 Random St, PN 063512698 4LN867
Butt 89 Yeah Pl, PN 063569986 D920HK
Handle 69 James Ct, PN 06 3549687 ZK26S84
If I wanted to filter the list so I only had codes that had Z, N, H in it. How do I do that??
I'm trying to count the number of non-empty cells beneath a reference cell and would be most grateful for a few pointers. The code I currently have (that doesn't work) is:
View 2 Replies View RelatedI have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
I need a formula for H2 to multiply the value if it is in any one of the cells in B2 - B6 by the appropriate value to calculate the annual total. Such as if the number is in weekly column it would multiply by 52, fortnightly 26, monthly 12, quarterly 4 and annually 1.
Weekly
Fortnightly
Monthly
Quarterly
Annually
Ann Totals
Mortgage
1000.00
Council Tax/Water/Sewerage
1000.00
I want to calculate ONLY if a cell is > the number manually entered in another cell, otherwise, I want the cell to populate with 0.
I need assistance with combining the following into a single calculation:
IF D11 is > D10, then D14 should = sum of D12-D10
If D11 is
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
I have students Kg-5th Gr. I need to identify the ones over-aged when I enter the information. The following is what I'm trying to use but I get Y1 for ever cell. I need it to Identify the student as Y1 for One year overage and Y2 for tow years overage.
View 3 Replies View RelatedI've got a single column worksheet with a varying numbers of characters in each row.
At the end of each row's cell value I must add a 5 char string. Preceding that string I must have enough spaces to make the total length of each row 106 characters.
I've already:Defined and populated the string. Let's call it "strMyString".Established how many rows are in the sheet and stored it in "lngUsedRange"Written the following which cycles through each row establishing how many spaces need to be added:
Dim lngSpacesNeeded As Long
For i = 1 To lngUsedRange
lngSpacesNeeded = 101 - Len(Range("A" & i))
Next i
Now I just need to know what else to put before "Next i" to locate the end of the existing text in the cell and add the number of spaces in "lngSpacesNeeded" then add "strMyString".
I have a spreadsheet which has a column that contains route numbers (for collection of goods). Some addresses have 2 or 3 route numbers within the same cell i.e.
3
3 20
3 20 15
I would like to know the formula for counting the number of cells that contain each route number i.e. from above 3 = 3, 20 = 2, 15 = 1