Creating Complicated Formula With Letters And Number
Apr 8, 2014
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
View 2 Replies
ADVERTISEMENT
Dec 7, 2009
I have words in cell range (i.e. A1:A1000) and I want them to became upper letters.
Excel forum to EXCEL FORUM
View 5 Replies
View Related
Jun 1, 2006
I recently added a formula to a spreadsheet with som complicated formula. It worked ok and I saved the sheet. Now it takes 5 minutes to open the sheet and when I try to do anything,like delete the inserted column the program locks up giving a no responding message. I can do without this column if I have to.
View 4 Replies
View Related
Dec 28, 2011
H4 is a date/time stamp I have saved as a macro. Returns 12/28/2011 10:47:00 AM.
I4 is the same macro and returns 12/28/2011 10:48:00 AM
J4 calculates the difference between the two (I4-J4), but only recognizes business hours and business days (Monday-Friday, 8:00 am to 5:00 pm)
I only want J4 to calculate if I4 is NOT BLANK.
These are in a table so J4 is trying to calculate when there is data in H4, but not I4, and returning a large number like 981583.22
When I try to apply IF(ISBLANK) logic to the formula in J4, I get an error that it exceeds 255 characters, even though it works fine if I am not trying to put the IF(ISBLANK) logic in.
Here is the formula in J4. I want it to automatically calculate if there is data in I4. Otherwise, I want it to return 0.
=IF(AND(INT(H4)=INT(I4),NOT(ISNA(MATCH(INT(H4),HolidayList,0)))),0,ABS(IF(INT(H4)=INT(I4),ROUND(24*(I4-H4),2),
(24*(DayEnd-DayStart)*
(MAX(NETWORKDAYS(H4+1,EndDt-1,HolidayList),0)+
INT(24*(((EndDt-INT(I4))-
(H4-INT(H4)))+(DayEnd-DayStart))/(24*(DayEnd-DayStart))))+
MOD(ROUND(((24*(I4-INT(I4)))-24*DayStart)+
(24*DayEnd-(24*(H4-INT(H4)))),2),
ROUND((24*(DayEnd-DayStart)),2))))))
View 1 Replies
View Related
May 29, 2012
I want a formula to do this... (x1*z1+x2*z2+x3*z3+....+xn*zn) where n is finite.
x1=a1
x2=a1+a2
x3=a1+a2+a3
xn=a1+a2+a3+...+an
z1 = 1.05^1
z2 = 1.05^2
z3 = 1.05 ^3
zn = 1.05^n
is this possible?
View 9 Replies
View Related
Jun 12, 2014
I want to set formula to cell S1 via vba.
This is the formula: =IFERROR(VLOOKUP(H3;'[VATCompanies.xlsx]1'!$A:$B;2;0);IFERROR(VLOOKUP(F7;'[VATCompanies.xlsx]1'!$D:$E;2;0);IFERROR(VLOOKUP(F7;'[VATCompanies.xlsx]1'!$G:$H;2;0);IFERROR(VLOOKUP(F7;'[VATCompanies.xlsx]1'!$J:$K;2;0);IFERROR(VLOOKUP(F7;'[VATCompanies.xlsx]1'!$M:$N;2;0);IFERROR(VLOOKUP(F7;'[VATCompanies.xlsx]1'!$Q:$R;2;0);I7))))))
View 8 Replies
View Related
Apr 16, 2006
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
View 9 Replies
View Related
May 6, 2009
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
View 5 Replies
View Related
Mar 9, 2007
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
View 10 Replies
View Related
Mar 1, 2013
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
View 1 Replies
View Related
Dec 12, 2013
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
View 9 Replies
View Related
Jul 5, 2007
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
View 9 Replies
View Related
May 27, 2009
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
View 9 Replies
View Related
May 11, 2008
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
View 6 Replies
View Related
Apr 15, 2008
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
View 9 Replies
View Related
Sep 11, 2013
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
View 4 Replies
View Related
Mar 31, 2014
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
View 3 Replies
View Related
Jul 31, 2014
I have an excel database where I register cases. I have in it a button that creates a folder with and ID nr that is in column A (I create new ID nr in the next row, when I press the button it will create a folder with that ID nr and inserts a blank word document in it). We have a template that we copy to the folder (depending what type of case). The idea would be that once the template is filled in and ready to print, It would take the values from the ID nr and a reference number a few cells to the right. Is it possible to tell excel to open the word document in the folder and create a PDF version with the ID nr and reference number. (there are only 2 templates, so the macro would have to look for one of the two in the folder) The names of the templates are: "Standard" and "Other". I guess the best way to start maybe this would be that I select the cell with the ID nr and then press a macro button to have this done. One thing that needs to be done, is to put a copy in the same folder and another in a second folder called "Binder" in my documents folder.
View 1 Replies
View Related
May 5, 2009
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies
View Related
Jan 14, 2009
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies
View Related
Apr 20, 2006
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies
View Related
May 2, 2006
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
View 4 Replies
View Related
Jan 23, 2014
I am a school teacher trying to adjust my tracking sheet to calculate pupils levels. I am looking for 2 potential formulas that will do the following.
1 - In cell AE I would like to generate a formula that will take the data entered in cells J:5, L:5, N:5, P:5, R:5, T:5, V:5, X:5, Z:5, AB:5 and AD:5 and give an average level.
2 - In cell AH is it possible to generate a formula that will calculate how many levels of progress the pupils are making - In other words I need Cell I to be calculated against cell J to see how much progress the pupils are making - for example if in cell I:5, a pupil is was given a 3a, and then in cell J:5 is given a 4b, they will have made 2 sub levels of progress. As well as this, can that progress then be averaged out across cells I:5, K:5, L:5, M:5, O:5, Q:5, S:5, U:5, W:5, Y:5, AA:5 and AC:5 to give an overall number of of levels of progress? An then..... can I colour co-ordinate the cell so that if the pupils are making 3 or more sub levels of progress it turns green, 2 sub levels orange and 1 sub level red?
Levels work like this
3c
3b
3a
4c
4b
4a
5c
5b
5a and so on
View 3 Replies
View Related
Oct 12, 2007
I am trying to validate a Grid Location, example: 22AX21321232
How do i validate letters in the formula?
View 10 Replies
View Related
Feb 15, 2014
I have two array formula's, one to count hours, the other to count days. Both are based on: type of worker, day of week, and week number. The problem is if I use a "V" or "T" for vacation or training, then the array formula will not work. Currently I leave the field blank if they are not working, but it would be nice to see whether they are on vacation or training. Is there a way i can have my cake and eat it too?
Counting Days
{=SUM(($E$5:$MN$50>0)*($B$5:$B$50=$D56)*($E$3:$MN$3=F$54)*($E$2:$MN$2=$E$67))}
Counting Hours
{=SUM(($E$5:$MN$50)*($B$5:$B$50=$D56)*($E$3:$MN$3=F$54)*($E$2:$MN$2=$E$67))}
Here is a breakdown of what each of the ranges mean:
$E$5:$MN$50 is the area which the hours are forecasted$B$5:$B$50 is the column for which type of worker (Electrician, Pipefitter, etc)$D56 is the specific type of worker we are counting for$E$3:$MN$3 is a row with all the week days ("Fri, Sat, Sun...)F$54 is the specific day we are counting for$E$2:$MN$2 is a row with all the week numbers$E$67 is the specific week number we are counting for
View 8 Replies
View Related
Oct 29, 2008
formula to add letters but with a numeric value. this is for a schdule sheet. where w would equal 7.5 and x would be 0.
i am using this
=SUMPRODUCT(--(ISTEXT(B3:H3)))*7.5
reads the w and adds up ok but need to be able to put w for work and x for off days and still add the total hours
View 5 Replies
View Related
Aug 18, 2008
Looking to create a Formula (not Code):
IF CELL A1
1. NOT Between 8 and 20 characters OR
2. NOT contain at least 2 numbers OR
3. NOT contain at least 2 letters OR
4. contain characters (e.g. punctuation) which are neither numbers or letters
Then FALSE.
View 9 Replies
View Related
Jul 29, 2014
i have a list of 2000 fields which have the same format IE "AB10014"
I need to remove the "AB" from every field and leave the #.
Besides putting a space and running text to columns I'm not sure how.
View 13 Replies
View Related
Jul 24, 2012
I have a column of cells, some blank, some containing just numbers, some containing just letters, some containing numbers preceded by the the letter 'p'
E.g.
frt
34.2
36
p34.5
In the cells containing the number preceded by the 'p' - i would like to remove the 'p' leaving just the number, with all other cells remaining unchanged.
View 3 Replies
View Related
May 21, 2014
In Column A I have first names, In column B I have last Names, in column C I have id letters,
Column D another list of First Names And In Column E I have another list of Last Names
So what I need to do in F2 is Look at the name Last name in E2 (Lets say its Smith) then look down the Last names In Column B when you find a match look at the First name on the same row to see if the first 3 letters are the same as the first 3 letters in D2 if they are then put the id that's in cell C into F2 if not ""
I've been trying for hours but no luck, also if you do manage to do it can you tell me how you get it to look at the first 3 letters and how I could change that to 4?
View 9 Replies
View Related
