I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I have the following column: A1 B1 B3 Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing AC125 1587 AF123 1365 AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
ii there a function that will count the number of different letters within a cell. Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
The content of Cell A1 looks like this attccggttaattcccccaaaattt (only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom() Dim b() As Boolean, e As Range, k&, x& Dim lRow As Long With Sheets(1) lRow = .Range("F" & .Rows.Count).End(xlUp).Row
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1 m543 fst998-2 m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
I have a column of cells, some blank, some containing just numbers, some containing just letters, some containing numbers preceded by the the letter 'p'
E.g.
frt 34.2 36
p34.5
In the cells containing the number preceded by the 'p' - i would like to remove the 'p' leaving just the number, with all other cells remaining unchanged.
I'm making a Excel 2013 spreadsheet that has formula in a column that auto enters a number 1-40 when something is entered to the left of that cell. There are 300 rows in the spreadsheet. I would like to make a drop down list in a column cell to the right that would delete that number in that cell from the drop down list. For example cell C1 has 39, that 39 then is deleted from the drop down list. C2 has 22 in it, click on the drop down list cell and it shows 1-40 less 39 and 22.
Is there a VBA command to get the letters, instead of the numbers, of the column of a selected cell?
I have to letter a list whihc means setting up a loop using character codes.
I may have to go into double letters so I am working on how I would set up the loop for if and when it gets past 90 and starts on double letters. so far the highest is the letter "U"
of course the easiest would be to pick up a column value as a letter
I have a column of numbers and want to make sure everything has been entered correctly from our scanning software. Basically, I want to automatically highlight any cell that has any letter in it (e.g. z12o2 instead of 21202 or R705 instead of 5705), ignoring any cells that contain only numbers. I haven't had any luck using conditions based on formulas like =ISTEXT.
I know the column number (57) and want the formula to return the column name (BE) Auto Merged Post Until 24 Hrs Passes;not using vba that is! or if so , a custom function so macros dont have to be run.
I've created an Invoice Template in excel. Each time I open it I'd like a certian cell "D3" to increase by one number starting at 2000. Each time this is opened a new customer information is input and then saved to their file. Please give me the very basicis on how to do this. I've already gone into other forums which have provided a code, but I have had any luck getting ti too work.
So i have 40K to spend, i want to eneter 40000 into a box and it will auto populate the number of units i can buy, always setting the weapon #6 as the priority.
Let's say 1) column A1 value is "35", any formula/macro can auto convert to "bc" at B1? 2) column A1 value is "ab", any formula/macro can auto convert to "13" at B1?
