Matching Set Pattern Of Letters And Number
Dec 12, 2013
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
View 9 Replies
ADVERTISEMENT
May 2, 2006
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
View 4 Replies
View Related
Jul 30, 2014
how can I modify the formula below so that after every row (i+60) the letter D changes to E then F, then G..... and so on. I want the following with the formula below:
=MAX($D$2:$D$61)
=MAX($E$62:$E$121)
=MAX($F$122:$F$181)
and so on...
[Code] .....
View 8 Replies
View Related
Dec 19, 2012
I would like to search for a certain pattern that appears in a cell. For example, I have certain cells that begin with a 7 digit project code (Ex: "1234567 - Project Red"). I was planning to use an IF inside a FOR loop and then do an action when I find the cell with the pattern. I thought I remember it being something like Format(########*) so that I have the wildcard on the end since there is more than just the numbers. how to make other patterns work such as Number-Letter-Number or Capital-Lowercase-Capital
View 3 Replies
View Related
May 19, 2008
I need to have a string comparison done in a macro,
I have a files with names similar to "TEVT_GURUPRASAD_WEEK08" and a array of strings having names "Guruprasad,AnilKumar,....etc." I Need to match the name in the array and the name in the filename.
View 9 Replies
View Related
Oct 2, 2008
I am a beginner to VBA and Macros, and I have a fairly complicated macro that I am pressed to make.
I am working with alphanumeric data that is unorganized. Here is an example of what it looks like: ...
View 7 Replies
View Related
Apr 28, 2007
Using the Find Function in VBA with pattern matching, I want to find the End statements in my code. How do I stop it finding the End If statements, of which there are hundreds maybe thousands. I tried End[ ][ ][ ] and End[!I] etc but they exclude the End statements as well.
View 3 Replies
View Related
Jun 1, 2014
I need to find and match patterns of strings in a column and fetch data from the adjacent column. I've attached a sample workbook with my sample data.
How can I find the appropriate matching pattern and fetch and fill data from the adjacent column from my source table to destination? I tried the string functions available and used SEARCH function to match the pattern and check whether it is available. However, when the pattern is found, how can I fetch the adjacent column ?
My attempt to code a formula using SUBSTITUTE, MID and SEARCH functions. Below is the monster formula I wrote - it works and returns 1 when the pattern is found.
Formula:
I need to return the matching pattern that is found. And with it the corresponding adjacent cell's value.
Attached File : Find_Pattern_Match_and_Fetch.xlsx
View 14 Replies
View Related
May 21, 2014
In Column A I have first names, In column B I have last Names, in column C I have id letters,
Column D another list of First Names And In Column E I have another list of Last Names
So what I need to do in F2 is Look at the name Last name in E2 (Lets say its Smith) then look down the Last names In Column B when you find a match look at the First name on the same row to see if the first 3 letters are the same as the first 3 letters in D2 if they are then put the id that's in cell C into F2 if not ""
I've been trying for hours but no luck, also if you do manage to do it can you tell me how you get it to look at the first 3 letters and how I could change that to 4?
View 9 Replies
View Related
Jan 31, 2007
Pre-requisite: I would consider myself to be very poor with excel, based on what I've read on this forum and found on my web-searches. I have a worksheet that has a list of data on the left going vertically, then a summary of this data going horizontally across the top. It is not arranged in such a way that transposing the data will do what I want. I am pulling the 5th word out of the title of each block of the vertical data and need to show this word on the horizontal section.
When I use this formula to pull the 5th word: =MID(MID(MID(SUBSTITUTE(A2," ","^",4),1,256), FIND("^",SUBSTITUTE(A2," ","^",4)),256),2,FIND(" ",MID(MID(SUBSTITUTE(A2," ","^",4),1,256),FIND("^",SUBSTITUTE(A2," ","^",4)),256))-2)
I need to increase A2 to A30, then A58 (up by 28 every time) in every instance in that formula. The fill handle increases the values by 1, instead of 28 (even if I do 3 or 4 instances manually) How do I do this? I've run into this problem in other scenarios, and there HAS to be a way to get around it.
View 5 Replies
View Related
Jun 10, 2014
I want the first 60 rows of column C to be constant meaning C1, C2, C3, C4..C59 and after 60 rows it should start again with C1, C2, C3.....C59 rather than C60, C61, C62. In other words i+1 but after 60 rows i should be reset to 1 and then again increase by 1. how can i implement these changes
[Code] ......
View 2 Replies
View Related
Jan 21, 2008
What I want to do: find the four cell that have the same value "99" in belows configurations
A B C D
1 99
2 99
3 99
4 99
A B C D
1 99
2 99
3 99
4 99
View 9 Replies
View Related
Apr 16, 2006
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
View 9 Replies
View Related
May 6, 2009
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
View 5 Replies
View Related
Mar 9, 2007
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
View 10 Replies
View Related
Mar 1, 2013
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
View 1 Replies
View Related
Jul 5, 2007
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
View 9 Replies
View Related
May 27, 2009
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
View 9 Replies
View Related
May 11, 2008
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
View 6 Replies
View Related
Apr 8, 2014
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
View 2 Replies
View Related
Apr 15, 2008
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
View 9 Replies
View Related
Sep 11, 2013
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
View 4 Replies
View Related
Mar 31, 2014
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
View 3 Replies
View Related
May 5, 2009
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies
View Related
Jan 14, 2009
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies
View Related
Apr 20, 2006
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies
View Related
Jul 29, 2014
i have a list of 2000 fields which have the same format IE "AB10014"
I need to remove the "AB" from every field and leave the #.
Besides putting a space and running text to columns I'm not sure how.
View 13 Replies
View Related
Dec 7, 2009
I have words in cell range (i.e. A1:A1000) and I want them to became upper letters.
Excel forum to EXCEL FORUM
View 5 Replies
View Related
Jul 24, 2012
I have a column of cells, some blank, some containing just numbers, some containing just letters, some containing numbers preceded by the the letter 'p'
E.g.
frt
34.2
36
p34.5
In the cells containing the number preceded by the 'p' - i would like to remove the 'p' leaving just the number, with all other cells remaining unchanged.
View 3 Replies
View Related
Nov 23, 2009
In need of help on formula to look up matching numbers between cells.
Cell H3 has 6
I3 has 7
J3 has 5
-
D3 has 6
E3 has 7
J3 has 3
Would like a formula on cell L3 to showcase how many matching numbers in H3:J3 when matching up with D3:J3. In this example, there are 2 numbers that matched, 6 and 7. So on L3 it shows 2. How many matching numbers are there L3 shows it.
View 9 Replies
View Related
