How To Sort A Column Depending On Number Of Letters
Apr 15, 2008
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
View 9 Replies
ADVERTISEMENT
Aug 12, 2007
I am attempting to sort a column with mixed letters and numbers. However, I have been totally unable to get them to sort the way I want them.
What I have is:
K600
K2
K2A
K2B
K159
K159A
K159B
K1
K1A
K1B
K428
K8
K8A
K8B
etc, etc. The prefix letter is only a K - no other letters. However, the suffix letters can be anything from A to E (at the present time)
I need to sort them numberically from K1 in descending order ie:
K1
K1A
K1B
K2
K3
K4
K4A
K4B
etc etc etc
View 9 Replies
View Related
Jun 1, 2008
I know the column number (57) and want the formula to return the column name (BE) Auto Merged Post Until 24 Hrs Passes;not using vba that is! or if so , a custom function so macros dont have to be run.
View 3 Replies
View Related
May 2, 2006
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
View 4 Replies
View Related
Jul 24, 2012
I have a column of cells, some blank, some containing just numbers, some containing just letters, some containing numbers preceded by the the letter 'p'
E.g.
frt
34.2
36
p34.5
In the cells containing the number preceded by the 'p' - i would like to remove the 'p' leaving just the number, with all other cells remaining unchanged.
View 3 Replies
View Related
Jan 4, 2008
I have a list I want to sort containing both letters and numbers. Right now the regular sort sorts like this
ABC-1
ABC-11
ABC-12
ABC-2
I want it to sort like this and don't have a clue how to do it
ABC-1
ABC-2
ABC-11
ABC-12
I am using excel 2003
View 9 Replies
View Related
Nov 17, 2009
Is there a VBA command to get the letters, instead of the numbers, of the column of a selected cell?
I have to letter a list whihc means setting up a loop using character codes.
I may have to go into double letters so I am working on how I would set up the loop for if and when it gets past 90 and starts on double letters. so far the highest is the letter "U"
of course the easiest would be to pick up a column value as a letter
NT values do not get a number
A_____ _____NT###
B_____1_______C####
C_____2_______RMK###
D____ _______NT####
i am guessing the loop might involve some arithmetic test between the count and the character set 65-90. or maybe a mod thing.
View 11 Replies
View Related
Jun 3, 2007
I have 3 departments, each with a value. I want to sort from lowest value to greatest (which I have done) but some departments won't have a value and therefore will have "n/a" in the place of the value. When sorting, "n/a" always comes out as the greatest value but I want "n/a" to be the lowest value - since it means there is no value.
Here is an example of the data:
Depts: Value:
580 15.75
558 19.01
538 n/a
Here is the code (sorting is being done on the value obviously, and the switching of the Depts to stay with the value is also done in the code)
Private Sub RankPerformance()
Dim bytValuesArrayCount As Byte
Dim A As Byte
Dim B As Byte
Dim vTemp As Variant 'must be type since value can be number or string ("n/a")
bytValuesArrayCount = UBound(ValuesArray)
The only way I know to do it is to sort using the above code, then do another type of sort if a value is not numeric then it is placed at the end...but I'm trying to make the code as efficient as possible
View 5 Replies
View Related
Jan 7, 2010
Have a spreadsheet that contains a column of 3 digit numbers as well as 3 digit numbers with 2 trailing alpha characters.
Example:
376
377
421
376AB
376XY
377NC
421GQ
421EF
Need to sort by this column, but, with the parameter of sorting first by the numeric only, and then by numeric with alphas. So, the above list would look like this sorted properly:
376
376AB
376XY
377
377NC
421
421EF
421GQ
View 9 Replies
View Related
Jun 12, 2014
Attached is a copy of a spreadsheet that im working on, im trying to sort staff on their correct locations depending where i originaly select them.
The attachement will have more info
View 8 Replies
View Related
Aug 16, 2012
I wish to sort all of my rows depending on the value in only one of the columns. I do not know how to set this up, my data starts in row 7 and is in columns B:F, needs to be sorted by descending in column B.
View 1 Replies
View Related
Apr 3, 2014
I want to rearrange(sort asscending) columns based on numerical value in column header string through VBA macro. Please check attachment.
i.e. (Present Data)
# A B C D
1 col.1 col.4 col.3 col.2
(Output Data )
# A B C D
1 col.1 col.2 col.3 col.4
test.bmp
View 2 Replies
View Related
Jan 13, 2014
Using DataEntry sheet for data.
Trying to rearrange the data to DataFormatedProperly sheet.
So far all I can accomplish is DataFormatedWrong sheet.
Edit: Not sure what happened but file was NOT understandable before. It should be correct now.
View 2 Replies
View Related
Jan 21, 2012
Using the following data
R10-12128
R11-12x12x8
R11-12x12x8
R1-12x12x8
R1-12x12x8
R12-12x12x8
R14-12x12x8
R16-12x12x8
R18-12x12x8
R2-12x12x8
I want it to sort like this:
R1-12x12x8
R1-12x12x8
R2-12x12x8
R10-12128
R11-12x12x8
R11-12x12x8
R12-12x12x8
R14-12x12x8
R16-12x12x8
R18-12x12x8
What is the formula to achieve this?
View 5 Replies
View Related
Apr 16, 2006
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
View 9 Replies
View Related
May 6, 2009
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
View 5 Replies
View Related
Mar 9, 2007
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
View 10 Replies
View Related
Mar 1, 2013
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
View 1 Replies
View Related
Dec 12, 2013
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
View 9 Replies
View Related
Jul 5, 2007
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
View 9 Replies
View Related
May 27, 2009
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
View 9 Replies
View Related
May 11, 2008
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
View 6 Replies
View Related
Apr 8, 2014
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
View 2 Replies
View Related
Sep 11, 2013
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
View 4 Replies
View Related
Mar 31, 2014
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
View 3 Replies
View Related
May 5, 2009
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies
View Related
Jan 14, 2009
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies
View Related
Apr 20, 2006
i need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies
View Related
Nov 21, 2011
I have a column of domains.
I need to add "http://" to the beginning of these domains. How can I do this?
EX. I have column A with about 27 cells of domains "website.com". I want to add the "http://" to the front of them.
View 1 Replies
View Related
Feb 28, 2007
Using =column() in cell A1 returns "1" as column A is column 1 with b being 2 etc.
How can I get it to return "A".
View 9 Replies
View Related
