I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
I needed to know how to find the closest match to a reference number
regardless of whether its larger or smaller. I did a search and found a post
back in March that said to use the following:
=SUMPRODUCT(((ABS(list-target))=MIN(ABS(list-target)))*list)
I applied it to my application and it works, I just have no idea why. Can
anyone explain this formula to me or tell me where I can find a good
resource.
I am building a Workbook which takes data from SheetA and inserts it into SheetB.
Part of the data is only entered when a positive value exists.
I then do an export from SheetB.
The problem is that I need to get the column number and pass it to the cell reference based on the field name in row 1.
Dim sFindstring As String
Dim rFindcell As range
Dim iR As Integer
Dim iC As Integer
sFindString = " Find this string in the cell"
'Using cells find the findstring
Set rFindCell = Cells.Find(What:=sFindString, After:=[A1], LookIn:=xlValues, LookAt:=xlPart, SearchOrder:=xlByRows, SearchDirection:=xlPrevious)
'OK so look here
iR = 3
'I am trying to pick up the column number
iC = rFindCell.Column
rFindCell throws an object or with block variable not set error. Is there some property that I need to set.
I have several Excel workbooks that suddenly has converted to numbers for both columns and rows. Sheets that were saved and correct yesterday, upon opening today, are now numbered rather than number and letter. Any of my formulas now reference a RNumber and a number when citing location.
View 3 Replies View RelatedI can use find and replace to remove the following, however as I would be doing the same process numerous times it would be very tedious.
I would like 2 VBA scripts.
1 - replace the following letters (uppercase & lower) in Column A and C replace A, V, N, Z, X, Q
so if it finds A it would remove A from the cell.
The cells may contain other letters including these one's i.e
A123XCB235 or
123VBN7779A
2 - The second independent code would replace the characters replace A, V, N, Z, X, Q with P, M, L, R, J, H ie. A becomes P, V becomes M etc...
Again the cells may contain other letters including these one's i.e
A123XCB235 or
123VBN7779A
i have colums of data containing random figures containing letters and numbers.
I want to completely remove the letters from the colums, leaving me with just a numerical figure. Is there a way to do this? There is no set pattern to work with as there could be 1 cell with 2 numbers and 6 letters, and the next cell may have 6 numbers and 1 letter.
EG: COLUMN A
aaa567783a
3782dc
23388fjjas2
22dd
I want this to simply be
EG: COLUMN A
567783
3782
233882
22
In col A I have various text codes in no particular order: i.e.cell A2 is PM-A01, cell A3 is BTC05, cell A4 is PM-B00, etc. The first two positions are always alphabetic. I want to sum all the numbers in column B whose adjacent column A text starts with "PM".
I tried =IF(match("PM*",A2:A100,0),b2,"") but just get "NA"
Log sheet Col a = Dates
Col d = Route ( Letters and numbers)
Col F = Times (1.2-2.3- examples)
Log sheet has 1,550 rows +
How I have been finding total for the Last 12 months is the formula below
=SUMIF(LOG!A:A,">="&TODAY()-365,LOG!F:F)
Now what I would like to try and do is the same BUT.
using COL D (on LOG sheet) to find out when I went to for example "JTF"
be advised that COL D is a route, so there are many results in each cell in col d..
So examples below
COL F On Log sheet
OERT-JPF-JMF-ASG1-JTF
OERT-JTF-JTF-ADC17-ADC17-ARAB3-ARAB3-DHAMC-JSK
OERT-JTF-JTF-ASG1-R655-JPF-JMF-LCL-JTF
OERT-JTF-JTF-R655-DHAMC-HAW-DHMAC
OERT-JTF-JTF-JTF-HI4-HI4-R655-ADC38-RS55-ES76-JPF-JMF-JPF-JMF
OERT-JTF-JTF-HI4-R655-ADC38-ES76-PMT-FLIGHT TOUR VIPS
I am looking for a formula that will return the lowest value from a five cell range using letters instead of numbers. If the 5 cell range is empty the cell will remain blank. Not all the 5 cells may be used - it could be anywhere from 1 to all cells.The weightings of the letters in terms of their numerical value are as follows:
F=0
P=1
M=2
D=3
Examples of desired results:
From A1 to A5 the following letters are inputted: P M M D P. Result in A6 = P as P is the lowest numerically in the above list. B1 to B3 = D D M. Result in B4 = M. C1 = F. Result in C2 = F. All cells blank from D1 to D5 = cell in D6 remains blank.
formula to do the following:
Assign numerical values to the letters G, A, R each having the values of 3, 2 and 1 respectively and then take an average of their values. Please be aware that in some cells there may be no letter.
So in a 5 cell range the values could be:
blank, G, A, R, blank which equates to a result of 2 for an average, (3+2+1)/3 (the two blank cells are discounted).
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
I am trying to code a macro that will search through a selected range of cells for key letters, for instance this cell may contain any combination of B, C, Te, Tc, RH, or LH. I would preferably like to search with capitalization being a factor but it is not a deal breaker. Below is a sample of what i have if the cell has a B, C it works for B but ignores the C i need it t o recognize both.
Code:
If InStr(1, ActiveCell.Text, "B") Then Range("O" + CStr(ActiveCell.Row)).Select
With Selection.Interior
.Pattern = xlSolid
.PatternColorIndex = xlAutomatic
.color = 65535
.TintAndShade = 0
.PatternTintAndShade = 0
[Code] ........
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Replies View RelatedI have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies View Relatedi need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies View RelatedI am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
I have an excel database where I register cases. I have in it a button that creates a folder with and ID nr that is in column A (I create new ID nr in the next row, when I press the button it will create a folder with that ID nr and inserts a blank word document in it). We have a template that we copy to the folder (depending what type of case). The idea would be that once the template is filled in and ready to print, It would take the values from the ID nr and a reference number a few cells to the right. Is it possible to tell excel to open the word document in the folder and create a PDF version with the ID nr and reference number. (there are only 2 templates, so the macro would have to look for one of the two in the folder) The names of the templates are: "Standard" and "Other". I guess the best way to start maybe this would be that I select the cell with the ID nr and then press a macro button to have this done. One thing that needs to be done, is to put a copy in the same folder and another in a second folder called "Binder" in my documents folder.
View 1 Replies View Relatedi have a list of 2000 fields which have the same format IE "AB10014"
I need to remove the "AB" from every field and leave the #.
Besides putting a space and running text to columns I'm not sure how.
I have words in cell range (i.e. A1:A1000) and I want them to became upper letters.
Excel forum to EXCEL FORUM
I have a column of cells, some blank, some containing just numbers, some containing just letters, some containing numbers preceded by the the letter 'p'
E.g.
frt
34.2
36
p34.5
In the cells containing the number preceded by the 'p' - i would like to remove the 'p' leaving just the number, with all other cells remaining unchanged.