Filter Out Letters Put In After A Number In A Time Card Spreadsheet
Jan 14, 2009
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
How do I format a spreadsheet set up as a time card entry log so that I can enter 0543 and it appears as 05:43 AM and/or enter 1653 and it appears as 4:53 PM.
I have it formatted right now to show that data but I have to enter it as 05:43 and it appears as 5:43 AM which is what I want and the in/out times calculate with an end result of hours worked.
I want to do it without having to enter the colon.
I have a sheet which details specific card numbers in Column A, and the date and place of transaction in the Column B. This very long list contains multiple entries for each card number. What I would like to do is use Sheet2 to list each card number and the number of times it appears in the list.
I am trying to put together a userform based time card calculator. User inputs the time in the time out and how long of a lunch. Then the program will display total hours worked for the day. Ive attached what I have so far. The only thing that is not very clear is that I have one hidden textbox for the lunch. It is there only for calculating and the visible one is going to inc by :15 min.
I have a time card that is split into sections so there are a lot of SUM formulas. However, I need to include a space for breaks - 10 min.
How do I make everything convert comfortably?
Ex. 5 hours allotted to person A. 5 hours to person B. 1 hour 40 allotted to tasks. And 20 min per day for breaks.
Is there a way to format the cell so that it displays hours and minutes 1:35 = 1hr35min ?? All the formats available show it as time. I need it as a quantity of time rather than time of day so that the formulas will add correctly.
Just basic enter a start time in column A a finish time in column B and column C gives you total in hours and minutes and then maybe a way to sum those hours and minutes. how to do "Math" on time and how it should be entered (formatted) for it to work properly.
I am trying to put together a userform based time card calculator. User inputs the time in the time out and how long of a lunch. Then the program will display total hours worked for the day. Ive attached what I have so far. The only thing that is not very clear is that I have one hidden textbox for the lunch. It is there only for calculating and the visible one is going to inc by :15 min.
I'm working on a dynamic payroll spreadsheet that will automatically calculate the overtime worked in a week. Right now, I'm running into a snag. My issue is with the formula in Column R. Right now, as shown below, it is doing the calculation based on regular hours minus 40 to determine the OT time. The snag is very messy and it lay in this: while the row by row calculations for total overtime worked for the week is correct, the sum at the bottom is very much off. I need an accurate method to sum the hours of overtime for the given column.
Here are the guidelines for the pay periods and overtime:
1. The pay periods for the month go from the 1st to the 15th and the 16th to EOM (End of Month). This means that the pay period could end on any given day of the week. More on this in a moment.
2. A work week is defined as Sunday to Saturday.
3. Overtime is calculated based on the rule of anything over 40 hours in a given work week.
4. Holiday hours worked do not count towards the 40 hour mark in granting overtime since Holiday pay is automatically overtime.
If it were just a matter of a bi-weekly (every 2 weeks) pay period, I would simply state =IF(weekday(DATE)=7,Hours_Worked - 40,0), and tag a SUM(range) at the bottom. Unfortunately, with it being a semi-monthly (twice a month), the end of the pay period could be a Wednesday, so a reference to day of the week won't work unless the formula can dynamically determine which set of data to evaluate.
I'm completely willing to toss out the current method of determining overtime. This is the calculations sheet that references a cleanly formatted and designed time card on a tab called "Time Card", so this isn't the full workbook. In fact, once the whole thing is done, this calculation sheet will be hidden.
Columns M and N (which are formula referenced in Column P) are basic End - Start calculations and were hidden to simplify the display as well as the number of formulas displayed.
Column L (formula referenced) is a Yes/No display for if the date in question is holiday pay.
aboute searching big database (10000 rows) with names of streets for one town. Each day I get list with 50 address and I need to look in database to see details aboute street in wich is address. I was thinking of user form with listbox for list of 50 addresses and then use first four letters of that address for advanced filter. I'm stuck with code for that four letter thing. When I see the desired information I need to insert it to 50 address table.
I have a column of "timestamp" data (in mins) which i want to filter by a given time interval, say 10 mins. Then i want to count the number of records for each time interval and output the data to a sheet. how can i achieve this? through vba?
I attached a pic illustrating what i want to accomplish.
I have two spreadsheets, one gives me the beginning and end of civil twilight as a measure of day vs. night. The spreadsheet has Date/Time in the first column, and the value 45 in the 2nd column when it is night. The second spreadsheet has also 2 columns with date/time and body temperatures of a squirrel. I want to get basic statistics (mean and standard deviation) of the squirrel's nocturnal body temperature, that is for times when it is night (value 45). The tricky part is that Date/Time of both spreadsheets are different. The procedure has to recognize that the date/time of body temperature lies between the beginning and end of the value 45 blocks of the first spreadsheet.
I m trying to use an Autofilter to filter my cells with a Number Filter of is greater of equal to 4 and is less than or equal to 5.
But as you can see I would like to customise is using a range of 2 values which i have specified in Cell P1 and Q1.
I manage to figure out how to reference to this cell, but Im not sure how can i put my ">=" and "<=" operators into my code so i can get it to work exactly how i want as shown in Code 1.
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
'To identify the next blank row in the database sheet For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1 RowNum = Count_Row X = RowNum - 1 Sheets("Users").Range("A1" & RowNum) = "U000" & X Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
My goal is to be able to use a combo box on a userform to filter a spreadsheet. I need my users to select the dropdown arrow on the combobox, find the one value they need out of a list of about 50, and have the spreadsheet in the background filter based on that user selection. At this time my form has several checkboxes to filter the spreadsheet which works as expected but again, I think I need to use a combobox for this certain set of data in conjunction with the other checkboxes. Searching on the more obvious terms leads to lots of advice and code on how to filter results within a combobox, but not how to use a combobox to filter a spreadsheet.
I am trying to use 2 macro's to filter data in a spreadsheet.
Down the A Colum i have a series of names for different students and across row 1 i have a series of different exams (exam 1,2,3,4,5 etc).
I am trying to get a macro to work, whereby if i select for Example Jonny Briggs, it will display on a separate work sheet, all the exams that Johnny has passed.
Also, i am trying to use a second macro, so that if i say 'select exam 5', it will show me all the people who have passed exam 5.
With this filtering, i also want it to remove any columns or rows that are not applicable to the data i want to see. For example, if i want to see what exams Jonny Briggs has passed, i DON'T want to see which exams he hasn't. The same as if i want to see who has passed Exam 5 - i DON'T want to see all of the other exams
MACRO 1
Sub Copy_Row_With_AutoFilter1() Dim WS As Worksheet Dim WSNew As Worksheet Dim rng As Range Dim rng2 As Range
With Application .ScreenUpdating = False .EnableEvents = False End With
'Name of the worksheet with the data Set WS = Sheets("Sheet1") '
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I have the following column: A1 B1 B3 Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing AC125 1587 AF123 1365 AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
ii there a function that will count the number of different letters within a cell. Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
The content of Cell A1 looks like this attccggttaattcccccaaaattt (only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
I want to filter my results using a combo box on my spreadsheet. I don't mind how this is done, even if it just hides all of the information which isn't relevant. I've done it with a VLookup but I want to be able to edit it easily without the formula popping up. So if you click Barlcays, only barclays appears. I'd also like a button to reset if possible. I've attached an example of how I sort of want it to work.
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom() Dim b() As Boolean, e As Range, k&, x& Dim lRow As Long With Sheets(1) lRow = .Range("F" & .Rows.Count).End(xlUp).Row
i have a spreadsheet which i have attached, currently users have to filter each column to get the end result
I would instead, like to create a screen where by they answer questions, for example. a drop down box where they choose flow rate, ie. 0-5l/min 6-10 l/min and so on for each option and then they end up with the list of choices which meet their criteria
