How would I verify a postcode format that starts with a number followed by one or two letters, space, number, letter, letter, if correct displays correct if incorrect displays incorrect
View 14 Repliesi need to find a way to search for numbers in a cell that are attached at the end of a group of letters. ex. (xxxxxxxxx01-01-001). i want to search backwards in the cell going right to left. what i need to do is once i find the numbers i need to go to the last number ex. (......x01-.....) and in front of it place a space ex. (......x 01-.......). right now i havent come up with a formula that can do this.
View 9 Replies View RelatedI am looking to use the formula's to determine if the contents of a cell, match or meet a given formula.
In this case, 3 alpha + 3 numeric, e.g. ABC123.
I would want it to return a TRUE or FALSE.
I've done it the long way by tearing apart into the 1st through 6th characters, but would enjoy a more succinct method.
I have a column of numbers and want to make sure everything has been entered correctly from our scanning software. Basically, I want to automatically highlight any cell that has any letter in it (e.g. z12o2 instead of 21202 or R705 instead of 5705), ignoring any cells that contain only numbers. I haven't had any luck using conditions based on formulas like =ISTEXT.
View 2 Replies View RelatedI have data that I am trying to sort that starts with a number and contains a number within, then sometimes ends with a letter. Here is the dataset I will use as example.
1-TP-2
1-TP-4A
1-TP-11A
1-TP-12
13-TP-22A
13-TP-22B
13-TP-102
13-TP-103A
13-TP-103B
Excel wants to sort as:
1-TP-11A
1-TP-12
1-TP-2
1-TP-4A
13-TP-102
13-TP-103A
13-TP-103B
13-TP-22A
13-TP-22B
Is there a formula that I can use to sort the data in numerical order by the last digits exactly like the first dataset? There are all sorts of veriations of the first digits and the last, but the "-TP-" always remains constant.
I am trying to apply conditional formatting to highlight the cells in D column if it starts with 91099 or 91004.
I tried to do the same using wild card, and left function but didn't get the desired output.
I am having trouble setting up my cycle count spread sheet. For instance if my starting number is 1000 and when it reaches 0 or below it starts to count in minus when I just want it to automatically reset to 1000
View 3 Replies View RelatedI have a price list from a friend. The price list has to have every other row shaded. This part is no problem with the conditional format command.
The real trick, at least to me, is the background shade of the row is based on the first two letters in the left most column.
For instance:
Column A
CPST4
CPST5
FLADS3EC
FLADS2EC
FIL4
CP rows would alternate with one color while FL rows would alternate with a different color and FI rows would alternate with another different color. All other rows would have no shading.
MacOffice Excel 08 is used so no VB code can be used.
I have a database to which I am connecting a form, I need to have a unique ID for each record and due to the number of tables need to include letters in my numbering (ex. U00001, for Users; B00001, for Books; and V00001, for videos.) I have adjusted a very helpful macro I recieved from Roy Cox and am currently trying this code on the "user form":
Count_Row = 1
DATABASE_RECORDS = Sheets("Users"). Range("B1:B10000")
'To identify the next blank row in the database sheet
For Each DBRECORD In DATABASE_RECORDS
If DBRECORD <> "" Then Count_Row = Count_Row + 1
RowNum = Count_Row
X = RowNum - 1
Sheets("Users").Range("A1" & RowNum) = "U000" & X
Next DBRECORD
This is supposed to find the fill the "A" (ID) column after the "B" Column has been filled. Currently It is placing U0001 in cell A12 when all that is in the sheet is headers.
I need to find a formula that will find letters in a referance, for example i have referances like - MNE DJM & ZZPAR i need to find a formula that will find me the ZZPAR looking for "ZZ" i then want this to tell me what tpYe of referance number it is and put this into column Z.
Normal referance number like DJM and MNE i want this to show as "BROMLEY"
aND ZZPAR as "Chester"
I have tried something like the following but this is not working
I have the following column:
A1 B1 B3
Ab123 1278 what i would like is if cell A2 start with AB then B1 and if not then nothing
AC125 1587
AF123 1365
AR125 1259
I would like another cell to check the cell where i have the two letters and the numbers. if the cell start with the number that i am intrested then to confirm it to me, or to give me a value from another cell.
I am trying to count the number of certain letters in a given cell. I figured out the formula when there is not a repeat of a targeted letter. For example, if multiple C's appear in cell A1 I will only get a value of 1 and not the exact number.
Here is my formula.
=COUNTIF(F12:Q12, "*C*")+COUNTIF(F12:Q12, "*P*")+COUNTIF(F12:Q12, "*E*")+COUNTIF(F12:Q12, "*L*")+COUNTIF(F12:Q12, "*O*")
I am new in extracting data from excel .
There is a report that contains a various amount data, in one cell it describes the outcome in a summary format of how an issue was resolved.
Is it possible to search a cell of summary text that contains a set pattern with letters & numbers i.e."CL900962" then either place a "YES" or "NO" in another cell if found?
The pattern will always begin with letters "CL" followed by 6 digit number.
ii there a function that will count the number of different letters within a cell.
Example: If in cell A1 is LIVERPOOL then in cell B1 I want the number 7.
The content of Cell A1 looks like this attccggttaattcccccaaaattt
(only a,t,g,c -nucleotides). I want to know the max times C occurs in this cell and the position from the start. like that a, t, g.
here the answer is 5 times and distance is 13 from start.
Nice to meet you all. I'd be grateful for any help I could get on this as I have tried it and I'm a bit stumped...
What I need to do is the following:
Convert a 4 digit number (e.g. 1234) in a single cell to a 4 letter string (e.g BCDE) and have the output appear in another cell.
The conversion should be as follows:
0=A
1=B
2=C
3=D
4=E
5=F
6=G
7=H
8=I
9=J
0=K
So, for example, 3678 in one cell should be converted to DGHI in the target cell.
I have been trying to create a formula that will save me DAYS of messing around at work.
What I am trying to achieve is to have a sequence of numbers as follows:
BNA01A01 to BNA01A09 then have it change to BNA01B01 to BNA01B09.
This needs to be repeated for all letters to BNA01I09.
Then this sequence needs to be repeated to BNA12.
The last thing is for me to be able to change the formula in order to implement the same sequence on a separate sheet for BNB01A01 - BNB12I09 to BNL01A01 - BNL12I09
i want to sort a column in such a way that it starts with those cells having the highest number of letter. For example:
before:
AA
AAA
A
AAAAAA
AAAA
AAAAAAAAAAA
I want it to look like:
AAAAAAAAAAA
AAAAAA
AAAA
AAA
AA
A
Ofcourse the real list doesnt contain only "A"s. It contains of words and sentences.
How can i sort columns A as mentioned? The order of column A with other columns should not be destroyed be the sorting process.
I have column A and B , in Column A cells i have words that I need to count the number of specific letters from them.
like :
A2= Apples
I need B2 to show the number of letter "A" in A2's text.
Is it possible to add letters to this "Unique random number" generator it is very fast and takes only 5s to run on 50,000 rows, I have a different "Unique random Sequence generator" macro but it takes about 30 minutes to run on 50,000 rows
Code:
Sub generateuniquerandom()
Dim b() As Boolean, e As Range, k&, x&
Dim lRow As Long
With Sheets(1)
lRow = .Range("F" & .Rows.Count).End(xlUp).Row
[Code]...
I have the need to filter out letters put in after a number in a time card spreadsheet. I'm not sure that using a select case is the right approach. I need to allow the user to put in a number and a letter signifying what type of time it is. Each cell equals a date on a calendar. For example if the user puts in 8s then the code will add 8 hours to the total sick time, strip out the s and just leave 8 in the cell. The problem is that I need to deal with all of the other letters/symbols that they can enter. From what I know of VBA which isn't much a Select Case seems to be way to go without using a bunch of nested If statements. Here is what I would like to do but this doesn't work. This is a short example of what I have tried as far as Select Case goes.
View 6 Replies View RelatedI've been assigned an assessment involving excel (2007), which involves me creating a small business system.
Part of this system involves a spreadsheet with a list of engineers and the postcode range that they are allocated to to fix callout problems.
What I would like to know, is if a callout request is made using a postcode, is it possible to automatically assign the engineer to the request?
Example, J Scott's work range is NE10 - NE19
If I entered the postcode NE12 7TD into the callout request form, is it possible to use formula or VB to assign J Scott's ID to the callout request?
All suggestions and help are greatly appreciated, I would request that solutions are kept as simple as possible as long as it's not much to ask for D:.
A possible solution i've thought of is making 2 fields in each of the engineer's rows, one being the lowest area range, and the other being the highest (e.g. J Scott's would be 10 and 19 respectivly) from there, I could possibly use formulae to assign the engineer's ID, and get his details using VLOOKUP.
I am trying to compare two colums. They both contain numbers mixed with letters. I am wanting to match only the numbers in both not the letters. Example:
column a = m454 column b = fsh454-1
m543 fst998-2
m998 fsm434-1
my match is m454 and fsh454-1, m998 and fst998-2. The items can be in any order in the column. The end result I want to indicate the match by putting an X by column a item that matches column b.
I'm trying to find a formula that will put a space in the correct place in a British postcode.
I have a column I need to sort this way. Some of the postcodes already have the correct space and others don't.
British postcodes can be in several formats......
n = a letter
1 = a number
n11 1nn
n1 1nn
n1 1n
n1n 1n
n1n 1nn
n11n 1n
n11n 1nn
nn1 1nn
nn1 1n
nn11 1nn
nn11 1n
On a side note I need to make all the text uppercase. In the column some already have uppercase and others don't.
I have this function that checks a postcode and returns a value using the first part of the postcode.
What i would like to know is how to modify the function so if there is only the first part of a postcode already entered, it looks for that.
At the moment sometimes i get #N/A even though i know that value is in there.
Code:
=INDEX(U$4:U$1068,LOOKUP(1068,MATCH(IF({0,1},LEFT(B338,FIND(" ",B338)-1),LEFT(B338,1+ISERR(MID(B338,2,1)+0))),T$4:T$1068,0)))
Column D contains a complete address eg
60 Braugham Road, Wallasey, Merseyside CH46 1LP
I would like to be able to extract the postcode into column E, and then the address into columns F, G, H etc so that I can use the data for mailmerge docs. Is there a forumula or a macro that can be used to identify and extract the postcode? The postcode will usually be either one or two letters with one or two numbers, then a number and two letters. eg it might be as above or B6 9XF etc.
I have a worksheet of customer data which includes full postcode / zip codes. I have a separate sheet where postcodes are listed. I would like to use the postcode list worksheet to find any address matches and then create a new worksheet of the filtered addresses (to include duplicates if found). Have attached a zip file of the spreadsheet data as an example.
View 4 Replies View RelatedHow can I sort the attached list both alphabetically and numerically. I have a list of UK postcode sectors which I am trying to sort alphabetically and numerically, the order should be eg AB1 0, AB10 1, G2 1, G20 1 but excel wont allow that sort order. There are three postcode formats
XX11 1
X1 1
X11 1
Where X an Y could be any letters in the alphabet and 1 could be any digit 0 to 9. Have attached a short list and formula in column B which would allow me to sort the list in column A which I can then apply to my full list.
Worksheet.xlsx
I have a very large spread sheet of about 20,000 rows. I need to output to a cell postcode ranges based on the Zone. Not all the numbers in the postcode zones are consecutive.
For the example below, the output cell for the DWN range would display like this: 0800-0801, 0804, 0810-0813
Each output cell postal range must be specific to each zone.
Postcode Zone 0200 CBA 0200 CBA 0221 CBA 0800 DWN 0800 DWN 0801 DWN 0804 DWN 0810 DWN 0810 DWN 0810 DWN 0810 DWN 0810 DWN 0810 DWN 0810 DWN 0810 DWN 0811 DWN 0812 DWN 0812 DWN 0813 DWN
Is there anyway to do this without manually doing it? I would like to tell you I've tried this and that but I've never done anything like this before so I really don't know where to start.
One of the reports I run provides me information on lengths of time. Such a field displays as |0:09:16| indicating 9 minutes and 16 seconds. However, when the report generates the excel spreadsheet it saves these cells in date/time format ([h]:mm:ss). If I were to convert this field to the number format (so I can manipulate and graph it) it displays as such |0.00643460648148148| Ideally I would be able to have the data in the field stored as |556| (556 seconds, or 9 minutes 16 seconds). I have thousands of fields that I need to manipulate where the data is stored in this format and I can not figure out how to fix it.
View 5 Replies View Related